Лпх кролики: О нас — Племенные кролики из Европы

Содержание

О нас — Племенные кролики из Европы

ЛПХ «Моряк»: продажа и разведение кроликов, породистые кролики из Европы под заказ, фото и видео кроликов, советы кролиководам.

Мы рады приветствовать вас на сайте племенного кролиководческого
хозяйства «Моряк»! Более 20 лет в г. Трёхгорном Челябинской области мы
разводим племенных кроликов и продаём по Уральскому региону, в
Сибири, европейской части РФ и в других государствах Таможенного
союза
. Другая специализация нашего хозяйства — доставка
породных кроликов из Европы под заказ. 

Столь широкая география наших покупателей связана с уникальным
племенным подбором животных в ЛПХ «Моряк». По нескольку раз в год мы
выезжаем в страны Европы, в лучшие кролиководческие хозяйства
Германии, Голландии, Чехии, Словакии, Латвии и других государств и на
международные выставки, чтобы пополнить племенное поголовье и
расширить породный состав животных.

Международные выставки — один из важнейших аспектов нашей работы. В
декабре 2012 года делегация ЛПХ «Моряк» стала

официальным
представителем Российской Федерации на главной международной выставке
кроликов в Лейпциге (Германия) — EUROPASCHAU 2012
. С этой
выставки мы привезли несколько животных с очень высокими оценками
международного жюри. Немало замечательных кроликов — победителей и
призёров — привезено с Международной выставки гигантских кроликов в
Вайдене (Германия), с 42-й Национальной выставки молодых кроликов в
Годонине (Чехия, Моравская Словакия), от легендарного заводчика
немецких ризенов Эвальда Кремера.

С подробными фото- и видеоотчётами о поездках, фото и видео кроликов,
сделанными лично мной — создателем и руководителем ЛПХ «Моряк»
Дмитрием Проваловым
— вы можете ознакомиться на сайте.

Продажа племенных кроликов в ЛПХ «Моряк»: вы можете купить


кроликов из Европы прямо сейчас или заказать любую породу по
европейскому каталогу!

Сегодня в нашем хозяйстве разводятся завезённые из Европы кролики
пород Бургундские кролики; Калифорнийские кролики.
Особой гордостью ЛПХ «Моряк» стал красавец Бельгийский
заяц
— порода редкая даже в Европе, а в России — уникальная. Сейчас мы уже не держим эту породу.
Однако список этот постоянно пополняется и меняется, поэтому мы советуем вам
следить за новостями сайта и не пропустить интересные и полезные
новости!

Все ввозимые кролики имеют племенные свидетельства или родословные кролика, международные
ветеринарные сертификаты, листы оценок

, выставленных
международными экспертами. Мы гарантируем покупателям приобретение
здоровых животных: по прибытии в РФ кролики содержатся в карантине под
надзором Управления Россельхознадзора (Челябинская область). Все
животные прививаются против ВГБК, пастереллёза, миксоматоза,
получают препараты против кокцидиоза и прочих кишечных
заболеваний.

Вы можете прямо сейчас позвонить или написать нам на электронную
почту, чтобы купить кролика или заказать любую породу по полному
европейскому каталогу!

Продажа сопутствующих товаров: у нас вы можете купить клетки для


кроликов, витаминные препараты,бункерные кормушки для кроликов,
антибактериальные ниппельные поилки, аэрозоль от всех видов клещей и насекомых,
инъекторы, клейматоры, самые полные европейские каталоги
кроликов

Из-за границы мы привозим не только кроликов — лучшие витаминные
препараты, ниппельные поилки и другие товары из Германии

вы можете
приобрести или заказать у нас.

В ЛПХ «Моряк» вы можете купить клетки для кроликов,
разработанные и опробованные в хозяйстве. Мы с удовольствием ответим
на любые ваши вопросы, проконсультируем по содержанию и разведению
кроликов.

ЛПХ «Моряк» — надёжное партнёрство и взаимовыгодное сотрудничество

ЛПХ «Моряк»включено в Реестр организаций и лиц Российской
Федерации, осуществляющих производство, переработку и (или) хранение
подконтрольных товаров, перемещаемых с территории одного государства —

члена Таможенного союза на территорию другого государства — члена
Таможенного союза.

Для ввоза животных на территорию РФ у хозяйства есть разрешение
Россельхознадзора.

Но главным разрешительным документом в нашей деятельности мы считаем
благодарные письма и долгие партнёрские отношения с покупателями, для которых племенные кролики из «Моряка» стали мощным
стартом в создании собственного кролиководческого хозяйства — как
маленького, так и большого, приносящего достойный доход.

Позвоните или напишите нам! Если вы ещё раздумываете — мы ответим
на все ваши вопросы. Если вы точно знаете, чего хотите в

кролиководстве, — мы подскажем, как этого достичь. И обязательно
привезём вам самых здоровых, красивых и плодовитых кроликов!

Обращаем ваше внимание, на данном сайте публикуются информационно-рекламные материалы. Не является офертой.

ЛПХ «Катюша» | Fermer.Ru — Фермер.Ру — Главный фермерский портал

Как все началось

Идея разводить кроликов возникла после покупки участка в 2012. Мы долго выбирали конструкцию клеток для содержания кроликов, способ содержания (улица, помещение). Остановились на уличном содержании, но в сильные морозы у некоторых пород, таких как, ризен, фландр и французский баран начинают отмерзать кончики ушей, что приводит к гибели кролика. Кроме того, в морозы практически невозможно получить окролы, напольный подогрев маточника не справляется с холодом в -25 и ниже. В этом году будем утеплять 2 навеса с кроликами.

В процессе эксплуатации клеток пришли также к решению установить ниппельное поение кроликов, так как наполнение канистр и мытье мисок отнимает довольно много времени. Полы в клетках тоже пришлось переделывать, от плоских и реечных полов у кроликов очень быстро развивается пододерматит и его лечение очень тяжело проходит. Перешли на содержание только на мягком подстиле.
Изначально планировали разводить кроликов на мясо, но в процессе изучения пород решили разводить только на племя. В октябре 2012г. мы вступили в «Добровольное Общество Кролиководов», которое оказывает помощь в разведении и содержании кроликов.

Достижения

В декабре 2012г. мы приняли участие в III Уральской выставке породной птицы и кроликов, проходившей в г. Екатеринбург. По итогам выставки мы заслужили 6 первых мест в породах кроликов и II место по итогам выставки.

Планы

В планах на 2013г. построить закрытое теплое помещение для вольерного (напольного) содержания крупных пород кроликов.

Предложения

Наше хозяйство, ЛПХ «Катюша», занимается разведением и продажей только породных кроликов. Хозяйство располагается в экологически чистом месте — г. Сысерть.

Мы разводим следующие породы: Ризен голд, Фландр, БСС (большое светлое серебро), НЗК (новозеландский красный), калифорнийская, сиамский, французский баран, японский, черно — огненный, тюрингенский, бургундский, ангорская пуховая, венский белый, венский голубой, венский черный, бельгийский заяц, рекс (кастр, черно-огненный, шиншиловый), голландский. Всё поголовье завезено из Европы.
Приобретая кролика у нас Вы получаете отличного племенного кролика. Кролики продаются, начиная с двух месяцев, все прививаются от ВБГК. Все кролики промаркированы (клеймо в ухе по системе клеймения ДОК).
Мы можем доставить кролика в любой город России. В нашем хозяйстве Вы получите все рекомендации для дальнейшего содержания и разведения кроликов.

Контакты:

Зинин Сергей Анатольевич.
Тел.+7 912 20 60 222
e-mail: [email protected] ru
Сайт: www.lph-kat.ru

Кролики в личных подсобных хозяйствах

Развитию кролиководства уделяется большое внимание. Проводят работу по увеличению производства кролиководческой продукции в личных подсобных хозяйствах граждан.
Для развития приусадебного кролиководства, повышения племенного качества основного поголовья кроликов, а также качества шкурковой продукции завозят ежегодно племенной молодняк из специализированных хозяйств.

Породы и разведение кроликов

У нас в стране разводят более 15 пород кроликов. В приусадебных хозяйствах получили распространение следующие породы: белый великан, советская шиншилла, черно-бурый, калифорнийский и новозеландский (скороспелые породы), серебристый (мясо отличается высокими вкусовыми качествами).

Для увеличения производства кроличьего мяса и мехового сырья следует скрещивать кроликов разных пород. Приплод от таких скрещиваний называется помесями. Помеси отличаются большой энергией роста, жизнестойкостью, высокой оплатой корма и превосходят в первом поколении обе родительские формы.
На племя помеси оставлять не следует, поскольку они дают менее продуктивное потомство. Наиболее эффективны такие скрещивания:

  • советская шиншилла Х белый великан
  • серебристый Х серый великан
  • венский голубой Х советская шиншилла

Не следует проводить родственное разведение, то есть спаривать отца с дочерью, мать с сыном, брата с сестрой. Для избежания его надо менять самцов. При родственном разведении потомство отличается замедленным ростом, низкой плодовитостью, слабым здоровьем, рождением уродов, мертворожденных, нежизнеспособных крольчат, обладающих слабым телосложением.

На племя крольчат отбирают сразу при отъеме от матерей в возрасте 45—60 дней. Оставляют молодняк только от чистокровных самок и самцов, обладающих высокой плодовитостью, молочностью, хорошими материнскими качествами, здоровых, жизнеспособных, скороспелых, хорошо развитых.

Отбраковывают отстающих в росте, со взъерошенным мехом, с тусклыми глазами, малоподвижных, инертных, плохо поедающих корм, с пороками телосложения: горбатая спина, свислый зад, кривые ноги, свислое одно ухо, впалая грудь, челюсти с неправильным прикусом. Отобранных на племя самочек отсаживают в клетки. Самцов сажают отдельно от самочек.

В 4-месячном возрасте второй раз осматривают молодняк, отбраковывают отстающих в росте, не соответствующих племенным и породным качествам и рассаживают по одному кролику в клетку.

При выращивании самцов на мясо их содержат большими группами, но к 4-месячному возрасту при драках получаются закусы на шкурках, и шкурки обесцениваются. Поэтому следует выявить драчуна и его отсадить. Окончательный просмотр молодняка производят при переводе в маточное стадо в 5—6-месячном возрасте.

На племя отбирают молодняк, родившийся с января по апрель. Летние и осенние крольчата значительно хуже растут и развиваются, их выращивают только на мясо и шкурку. Поскольку за период выращивания часть ремонтного молодняка отбраковывается, то первоначально его отбирают на племя в 2 раза больше требуемого количества.

Самцы по сравнению с самками имеют грубые формы телосложения, массивную голову, грубый костяк, сильные ноги. От самца потомству передается много наследственных качеств: плодовитость, молочность, жизнеспособность, телосложение. Самец должен быть хорошо развитым, сильным, красивым, отражающим тип породы по окраске, здоровью, без пороков телосложения, с высокой скоростью роста в молодом возрасте. На племя используются с годовалого возраста до пяти лет. Лучше, чтобы самец был крупнее самки и старше ее на 0,5—1 год.

Отобранные на племя самки должны соответствовать породе, хорошо поедать корм, быть нормально упитанными, не ожиревшими и не худыми, не злыми и не очень пугливыми. Пугливые и нервозные самки часто затаптывают крольчат и обладают плохими материнскими качествами.
В день молочная самка выделяет 300—400 г молока, маломолочная – 200 г. В кроличьем молоке содержится 16—20% жира, 10—15% белка, 1,7—1,8% молочного сахара и 2,6% минеральных веществ. Самки хорошо выкармливают 6—8 крольчат, а высокомолочные – 10—12 крольчат. Некоторые самки при больших пометах делают два гнезда и кормят детенышей по очереди.

Используют самок в течение 2—3 лет. Молодые самки более плодовиты и дают хорошее потомство. Самки 2-го и 3-го года использования часто жиреют при обильном концентратном питании, сезонном использовании, малом движении в тесных клетках.
Случка, как правило, проводится утром или вечером в клетке самца. Из клетки удаляют все лишние предметы, мешающие случке. Подсаживать самца в клетку к самке не рекомендуется, так как самец будет отвлечен новым помещением и процесс случки затянется. Самка считается покрытой после падения самца набок или назад с характерным урчанием. После первого покрытия животные отдыхают 2—5 мин, потом самец вновь кроет самку. Вторичное покрытие обязательно.

Случку следует проводить при наличии у самок следующих признаков: покраснение и припухание наружных половых органов; возбужденное состояние; при легком поглаживании рукой по спине самка ложится на пол клетки и вытягивается. Если охота прошла, самка успокаивается, наружные половые органы синеют. Иногда она не дается самцу, но в охоте, тогда ее переносят к другому.

Во время проведения случки кроликовод не должен оставлять самку в клетке самца надолго (1— 2 ч) или на ночь, это ослабит животных и может привести к гибели. После спаривания самку сажают в клетку, где она должна кролиться, и больше ее не пересаживают. В журнале или на трафаретке записывают дату случки и номер самца.
Повторную случку рекомендуется проводить через 7—8 дней; покрытая самка обычно отбивает самца, но иногда самки принимают самцов. Однако кролятся по дате первой случки.
Сукрольность самки длится 28—32 дня. При ложной беременности самка начинает устраивать гнездо на 17-й день после покрытия, в этом случае ее, следует сразу покрыть.

Окрол и отсадка крольчат

За 5—6 дней до окрола самка устраивает гнездо, устилает его сеном, перемешанным с пухом, вырванным из брюшка или боков. За 10 дней до окрола в клетку ставят чистый продезинфицированный маточник (ящик). Окролы проходят чаще ночью, длятся 15—20 мин. После окрола самка облизывает крольчат, поедает послед, укладывает крольчат в гнездо, укрывает пухом и кормит.

Часто молодые самки не успевают сделать гнездо, тогда кролиководу следует самому устроить ей гнездо, крольчат осторожно уложить и покрыть пухом. Если самка сделала гнездо вне маточника, хорошо укрыла крольчат, кормит, то переносить их в маточник не следует во избежание потери молодняка. При окроле и после него не следует тревожить самку и осматривать гнездо, если пух шевелится, крольчата не разбросаны.

В случае, когда самка разбрасывает крольчат, их аккуратно собирают в гнездо и покрывают пухом; если самка выбросила крольчат из гнезда и они от холода начинают мерзнуть, их немедленно собирают, укладывают в корзину с мягкой теплой подстилкой и ставят в теплое место. Крольчата, отогреваясь, оживают.

На другой день после окрола осматривают гнездо, подсчитывают родившихся крольчат, удаляют мертворожденных. Перед осмотром каждого гнезда хорошо моют руки хозяйственным мылом, натирают их пухом из осматриваемого гнезда; в противном случае самка, почуяв чужой запах, загрызет всех крольчат, приняв их за чужих.

Пересаживать крольчат к другой самке нужно осторожно. Для этого следует отвлечь самку, дав ей более вкусный корм (траву, веточки, кору, корнеплоды и др.). Крольчат предварительно очищают от материнского пуха, обертывают в пух матери-кормилицы и осторожно укладывают в середину гнезда. Хорошей самке можно подложить несколько крольчат, но общее количество их не должно превышать 8—10. Нельзя класть приемышей к заведомо агрессивной самке.

Чтобы иметь возможность пересаживать крольчат к другим самкам, следует проводить одновременные случки нескольких или всех имеющихся самок. Во время окрола и после него в поилке обязательно должна быть вода в достаточном количестве, иначе самка, испытывая сильную жажду, может съесть своих влажных крольчат.

В дальнейшем по мере роста молодняка следует систематически наблюдать за гнездами самок. У низко­молочной самки крольчата голодные, расползаются по клетке, шерстка у них тусклая, они жалобно пищат, отстают в росте, вылезают из гнезда в поисках пищи. В этом случае надо отсадить крольчат к другой самке, но если ее нет, то применить принудительное кормление несколькими самками по очереди следующим образом.

Все гнездо вместе с самкой уносят в темное помещение, самку кладут на спину и подкладывают к соскам крольчат, когда крольчата будут накормлены, их снова уносят в клетку. Через 2 ч кормление повторяют и так делают до тех пор, пока крольчата окрепнут и самостоятельно смогут поедать корм.
Крольчат отсаживают от самок в 45-дневном, а в лучшем случае – в 60- и даже 70-дневном возрасте. В это время крольчата уже самостоятельно поедают корм, сильные, здоровые и меньше подвергаются желудочно-кишечным заболеваниям.

Отсаживать одновременно всех крольчат от самки не следует, сначала надо отсадить более сильных и упитанных, а более слабых оставить, пока не подрастут и не окрепнут.
После отъема крольчат самке дают отдохнуть 7—10 дней, чтобы вновь получить хорошее потомство. При полууплотненных окролах отнимают крольчат 40-дневного возраста, а при уплотненных – в 28 дней. Проводить полууплотненные и уплотненные окролы можно в редких случаях и очень осторожно во избежание гибели самки во время родов. Крольчата, отнятые в 28 дней, слабые, плохо растут и развиваются.

Уплотненные окролы проводятся при необходимости: если самка окролилась и пришла в охоту, разбрасывает крольчат, ее следует покрыть, чтобы спасти уже имеющихся крольчат. При полууплотненных окролах кормящую самку покрывают через 30 дней после окрола. Такие окролы проводят не более 1 раза в год при малых пометах (2—3 крольчонка в гнезде) или если самка здорова, хорошо упитана, всегда имеет доступ к концентрированным и сочным кормам, к воде.

Плодовитым самкам, выкармливающим одновременно 8—12 крольчат, полууплотненные окролы противопоказаны даже при обильном питании.
Если самка систематически затаптывает и загрызает крольчат, ее следует выбраковать, но сначала следует выяснить причину и постараться ее устранить. Причин очень много, и не всегда их сразу можно распознать: неправильное, одностороннее кормление, отсутствие воды во время окрола, несвоевременная послеродовая охота, шум на ферме, присутствие посторонних людей, собак, крыс, наличие за стенкой клетки самца, болевые ощущения от покусанных сосков у маломолочных самок, пересадка самки за 2-3 дня до родов в новую клетку, запахи вызывают у нее раздражение и нервозность.

Содержание кроликов

Лучшим способом является наружное содержание взрослых кроликов в индивидуальных клетках, а молодняка – в групповых. Кролик не боится морозов, он легко выносит температуру до —30…—35°С, но страдает от сквозняка, сырости и духоты.
Клетки строят на ровном сухом участке, вдалеке от проезжих дорог, располагают задней стенкой в сторону господствующих ветров, фасадной – на юго-восток. Во избежание перегрева их лучше устанавливать среди деревьев.

Для содержания кроликов в приусадебных хозяйствах могут быть рекомендованы деревянные клетки, смонтированные в блоки по 20 шт., установленные на бетонных пустотелых трубах на высоте 90 см от поверхности почвы.
Размеры клетки (на одного кролика): длина 110 см, ширина 120 см, высота передней стенки 95 см, задней – 75 см. Дверка по фасаду сетчатая. Пол деревянный, с наклоном к задней стенке на 20°, со щелью 3 см для стока влаги. Крыша односкатная с козырьком 40 см.

В клетке должна быть кормушка для комбикорма или зерна и кормушка для сена или травы, поилка, маточник длиной 60 см, шириной 40 см, высотой 30 см, с лазом диаметром 18 см, высота переднего бортика 9 см (чтобы не выползали крольчата). Помимо основных функций маточник служит стеллажом для отдыха самок и укрытием для самцов и самок в холодное время года. Он легко вынимается и дезинфицируется. Крольчат выращивают в такой клетке с момента рождения до отсадки, им не приходится переживать стрессового состояния от пересадок. В таких открытых клетках получают в год 3—4 окрола. Для зимних окролов их следует установить в сарае.

С целью экономии места можно построить двухъярусные клетки длиной 80 см, шириной 70 см, высотой 50 см. Полы делают реечные, рейки укладывают не вдоль, а поперек под углом 45°. Размер рейки 6 см, расстояние между ними 2 см. В этом случае кролики при подходе к кормушке не травмируют лапы и все нечистоты проваливаются в поддоны, которые устанавливаются между ярусами. Можно крышу клетки 1-го яруса покрыть шифером или пленкой и установить клетки с таким расчетом, чтобы все нечистоты убирать с задней стороны сарая через заслонку в наружной стенке клетки.

Кормление кроликов

Кролики питаются в основном растительными кормами – травой, сеном, древесными побегами, вениками из лиственных деревьев, хвойными ветками, корнеплодами, различными отходами от стола, ботвой овощей, картофелем, комбикормом, зерном. Они с удовольствием поедают одувднчик, но систематическое скармливание только одуванчика вызывает у них желудочно-кишечные расстройства. Очень хорошо они поедают подорожник, полынь, тысячелистник. Можно скармливать кроликам молодую крапиву, лебеду, лопух, сурепку, молочай.

Летом основным кормом является трава. При скармливании ее необходимо следить за тем, чтобы трава не была смочена росой или дождем, при лежании не согревалась. Свежескошенную траву перед скармливанием немного провяливают под навесом. Очень важно следить за тем, чтобы не попадались ядовитые травы (ветреница, зверобой, чистотел, дурман, белена, белладонна, хвощ болотный, лютик едкий).

Брюква, кормовая свекла, турнепс, морковь, капуста, картофель и другие овощные культуры, ботва моркови, свеклы хорошо поедаются кроликами и повышают молочность самок. Картофель лучше скармливать в вареном виде, все корнеплоды – в сыром, большими кусками. Капусты дают не более 150 г в день, иначе она вызывает желудочно-кишечные заболевания.

Зимой основной корм сено. Оно должно быть зеленого цвета, убранным в начале цветения, ароматным, мелкостебельчатым, разнотравным, незаплесневевшим. Кролики хорошо поедают злаково-бобовое, бобовое и разнотравное сено, сенную и травяную муку, ветки осины, ивы, вербы, сосны, ели.
Кроликам следует скармливать комбикорм и зерно злаковых в сухом виде, запаривать и заваривать их не нужно. Мелкий комбикорм смачивают водой во избежание засорения дыхательных путей кролика.

Зимой кроликов кормят 2 раза в день: утром – комбикормом и корнеплодами, вечером – сеном или вениками. Летом кормящих самок и молодняк после отъема кормят 3—4 раза: утром – комбикормом, днем и вечером – травой. Осенью откормочному молодняку дают корм 3 раза в день: утром и вечером – влажную мешанку из вареного картофеля с отрубями, отходами от стола, днем – траву, ботву.

Каждый кроликовод должен помнить, что любой корм, скармливаемый кролику впервые, вводится в рацион постепенно, малыми количествами во избежание желудочно-кишечных заболеваний. Кролик постоянно жует, он около 70—80 раз в день подходит к кормушке, ест часто, но понемногу. Большие перерывы в кормлении могут привести к заболеванию желудочно-кишечного тракта, запорам, поносам, вздутиям. Лучше всего кроликов кормить вволю концентрированными кормами из бункерных кормушек, травой и сеном из кормушки, куда можно сразу закладывать большое количество корма.

Если отсутствует комбикорм, то следует давать соль (1,5—2,0 г), опрыскивая соленой водой сено или траву, и мел (1,5—2 г). Ежедневно кроликов следует поить 2 раза в день – утром и вечером. Недостаток воды ведет к ухудшению усвояемости кормов, к заболеванию. Особенно чувствительны животные к отсутствию воды при кормлении гранулированным комбикормом и сеном. При введении в рацион травы, корнеплодов потребность к воде несколько снижается. Особенно высокая потребность в воде у сукрольных и лактирующнх самок. Самка с крольчатами в сутки потребляет до 3 л воды. Молодняку необходимо больше воды, чем взрослым животным, – 0,3—0,4 л. Зимой воду подогревают до 20°С.

Время забоя кроликов

Для кроликовода важно правильно выбрать время забоя. Его определяют в основном по состоянию линьки и густоте волосяного покрова. Взрослые кролики линяют дважды в год – весной и осенью. Более ценные шкурки с пушистым, густым и блестящим мехом получают при убое кроликов после окончания осенней линьки (с конца ноября по март). У молодняка проходят две возрастные линьки: первая заканчивается к 4—4,5 мес, вторая – к 7—7,5 мес.

В зависимости от условий кормления и содержания, сезона и времени рождения сроки линьки могут сдвигаться. Поэтому забивать кроликов надо выборочно.
При линьке кожа цветных кроликов бывает синего цвета, а когда линька закончена, кожа становится бело­розовой.
Раздувая волос на различных участках тела кролика, можно заметить на коже синеву. Это означает, что линька еще не закончена. Когда кожа на всех частях тела становится бело-розовой, кролика можно забивать. При забое в период линьки шкурки бывают с черными пятнами и слабой мездрой, легко рвутся.

Профилактика и лечение болезней кроликов

Распознать болезни и вылечить кроликов зачастую трудно и не всегда удается. Поэтому очень важно предотвратить возникновение заболеваний, а для этого соблюдать чистоту в клетках, устранять сырость, не допускать скопления навоза. Клетки необходимо ежедневно чистить, а летом мыть горячим щелоком, кормушки и поилки каждую неделю обмывать горячей водой.

Чтобы предотвратить заболевание молодняка, следует проводить профилактику в период подсоса и после отъема: добавлять в воду йод (10 капель на 1 л воды), перманганат калия (слабый розовый раствор). Поят кормящую самку этими растворами с первого дня после окрола в течение недели, весь подсосный период регулярно с 5-дневными перерывами. Отнятому молодняку дают раствор в течение 1—2 мес.

Кролики заболевают заразными и незаразными болезнями.

Инфекционный стоматит («мокрая мордочка») характеризуется воспалением слизистой оболочки рта, преимущественно языка, сопровождается слюнотечением. Если не принять срочных мер, можно заразить весь молодняк и взрослых животных. Признаки болезни – потеря аппетита, мокрые усы, грудь, лапки. Во рту образуются язвочки. Болезнь длится 10—12 дней, инкубационный период 2—4 дня. Кролики могут погибнуть и на 4—5-й день от голода.

Меры борьбы: просмотреть все стадо, продезинфицировать клетки 2%-ным горячим раствором едкого натрия или горячим щелочным раствором печной золы. Больным закапывают в рот раствор пенициллина (250 тыс. ед. растворяют наполовину в воде) или засыпают порошок стрептоцида в течение 3—4 дней подряд всем кроликам в гнезде.

Миксоматоз – острая инфекционная болезнь, распространению которой способствуют комары, кроличьи блохи. Механическими переносчиками болезни могут быть хищные птицы, человек. Кролики заражаются при контакте с больными и поедании зараженного корма.
Первые признаки заболевания: веки опухают, из глаз гнойное истечение, на различных участках тела небольшие, но быстро увеличивающиеся опухоли, отечность в области наружных половых органов. В начале больные кролики не теряют аппетита, но с развитием болезни появляются угнетение, сонливость, они отказываются от корма. Болезнь продолжается 4—8 дней, и обычно животное погибает.

Трупы животных вместе со шкуркой сжигают, мясо в пищу использовать нельзя. Клетки, инвентарь, предметы ухода дважды дезинфицируют горячим 2%-ным раствором едкого натрия и 1%-ным раствором формальдегида. При появлении миксоматоза немедленно уведомляют ветеринарного врача района. Для профилактики ветеринарные врачи весной проводят вакцинацию здорового поголовья кроликов.

Инфекционный ринит возникает в закрытых крольчатниках с недостаточной вентиляцией, при сквозняках, резких колебаниях температуры и пр. У кролика воспаляются и повреждаются слизистые оболочки носовой полости, он чихает. Из носа выделяется слизисто­гнойный секрет, шерсть склеивается, появляются зачесы. Поражаются легкие, слышатся хрипы и свист. Кролик малоподвижен, плохо поедает корм, худеет и через 2-3 нед. гибнет.
Лечению поддается очень трудно: животное лучше забить, мясо можно использовать в пищу.

Чесотка – инфекционное заболевание. Возбудитель ее клещ-накожник и зудень кроличий. Кожа на внутренней поверхности ушной раковины покрывается корками. Кролик беспокоится, трясет головой, уши свисают. Если запустить, болезнь может распространиться на среднее ухо, и животное погибнет.
Болезнь вылечивается легко: каждое ухо опрыскивают циодрином (аэрозоль) или смазывают смесью скипидара с подсолнечным маслом из расчета 1:2. На другой день корочки удаляют, клетку дезинфицируют.

Кокцидиозом заболевает молодняк, ослабленный после отъема от матерей до 3—4 мес. Возбудители – кроличьи кокцидии, их 10 видов. Один из видов паразитирует в печени кролика и вызывает печеночный кокцидиоз, а другие – в кишечнике (возбудители кишечного кокцидиоза). Обычно и тот и другой наблюдаются одновременно, и у каждого кролика обнаруживается несколько видов кокцидий. Заражение происходит только через пищеварительный тракт. Признаки заболевания – исхудание, потеря аппетита, часто – вздутие живота, понос. Через 10—15 дней кролик погибает.

Чтобы избежать постоянного заражения крольчат, следует ежедневно чистить клетки или содержать крольчат на реечных или сетчатых полах. Корм не бросать на пол клетки, а скармливать только в кормушке. Вода и корм не должны быть загрязнены калом.
При скармливании плесневелых, кислых, недоброкачественных кормов, при даче( нового корма в большом количестве возникают желудочно-кишечные болезни.
От большого количества травы, капусты и других сочных кормов заболевают взрослые кролики и особенно страдает молодняк после отсадки от матерей. Все эти заболевания сопровождаются вздутием живота, выделением слизи. При массаже живота слышен хрустящий звук.
Вылечить заболевшего кролика невозможно, лучше забить. Главное – устранить причину, вызвавшую заболевание, чтобы предотвратить распространение его в стаде.

В жаркое время дня кормящие и сукрольные самки, молодняк, содержащийся скученно в душных клетках, может получить солнечный или тепловой удар. Животные вялые, неподвижные, у них частое поверхностное дыхание, они много пьют. Смерть наступает внезапно. Необходимо больных кроликов перенести в прохладное место, голову поливать холодной водой.

Обращение в Генеральную прокуратуру: контрабанда, незаконное предпринимательство, биоугроза

В ходе нашего расследования русофобии на портале fermer.ru появилась очень интересная информация: http://zergulio.livejournal.com/4255414.html

Детально все изложено по ссылке, а если вкратце — на портале две структуры полным ходом торгую кроликами как собственными, так и из-за рубежа. Кроме них делать это может мало кто, Россельхознадзор бдит, скандал длительностью в полгода по ссылке выше подробно описан. Сотрудники Россельхознадзора красиво говорили о биологической угрозе и воозможном вымирании всех кроликов в регионе, если вдруг что не так.

Ок, бдительность так бдительность.

Начнем мы с  ЛПХ «Моряк» http://eurokrol.ru/

Очень ловкие люди, находятся в закрытом город в челябинской области, то бишь их ни проверить, ничего. Со слов фермера, закупавшего там кроликов — это делается без документов, просто деньги в обмен на стулья [зачеркнуто] кролика.

На сайте из данных — только телефон и почта, по телефону что-либо рассказать отказываются, зато про меня готовы говорить часами. Исподтишка мы не действуем, мы гордые, пытались несколько раз, запросы отправляли, но ответа нет даже на просьбу юрлицо назвать, адрес и т. п.

В принципе такая скромность понятна, на их сайте в разделе прайс порядок закупки кроликов вполне доходчивый:

Не совсем ясно, на каком этапе кролик обрастает сертификатами. И вообще, это точно кролик из Европы? А карта сбербанка она как — на частное лицо чтоль оформлена?

На мой взгляд, тут весьма вероятно А) незаконное предпринимательство и Б) мошенничество ИЛИ контрабанда. Контрабанда, понятно, гораздо вероятнее.

Плюс вероятность ввоза кроликов зараженных нехорошим, а в случае, если ввозят через Украину, у владельца fermer,ru там подвязки огого какие, то тут сюрприз может и СБУ прислать.

По итогу:

Заместителю Генерального прокурора РФ

Пономареву Ю.А.

От Колясникова Сергея Анатольевича

Уважаемый Юрий Алексадрович!

На территории Уральского федерального округа (ЗАТО «Трехгорный», Челябинская область) действует ЛПХ «Моряк», основным видом деятельности которого является продажа и разведение кроликов, в том числе, элитных.

При этом, в соответствии с ФЗ «О личном подсобном хозяйстве», не является предпринимательской деятельностью реализация лишь продукции, произведенной и переработанной при ведении личного подсобного хозяйства.

Вместе с тем, ЛПХ «Моряк» в качестве одного из основных видов деятельности осуществляет закуп животноводческой продукции за рубежом, ввоз её на территорию Российской Федерации и её реализацию, что уже само по себе является предпринимательской деятельностью.

Однако за счет того, что ввоз и реализация животноводческой продукции осуществляется под прикрытием личного подсобного хозяйства, данная деятельность ведется без какого-либо учёта со стороны налоговых и иных, контролирующих органов, и в качестве предпринимательской не зарегистрирована.

Всё это приводит к неконтролируемой деятельности по ввозу и реализации животноводческой продукции на территорию Российской Федерации со стороны руководителя ЛПХ «Моряк» — Дмитрия Провалова.

Так, на интернет сайте ЛПХ «Моряк»  http://eurokrol.ru/ указана следующая информация:

«Уже 15 лет в г. Трёхгорном Челябинской области мы разводим племенных кроликов и продаём по Уральскому региону, в Сибири, европейской части РФ и в других государствах Таможенного союза. Другая специализация нашего хозяйства — доставка породных кроликов из Европы под заказ.
По нескольку раз в год мы выезжаем в страны Европы, в лучшие кролиководческие хозяйства Германии, Голландии, Чехии, Словакии, Латвии и других государств. Вы можете купить кроликов из Европы прямо сейчас или заказать любую породу по европейскому каталогу!»

При этом, как следует из разъяснений начальника отдела продовольствия и сельского хозяйства посольства Германии в Москве Юдита Конс, между ЕС и Евразийским Экономическим Союзом не существует согласованного ветеринарного сертификата. В этой связи Ветеринарный сертификат на экспортируемых в Таможенный союз пушных зверей, кроликов, собак и кошек (Форма № 15) не может быть подписан германскими ветеринарными инспекторами.

Таким образом, по мнению посольства Германии в Москве, вывоз кроликов из Германии (и в целом, из ЕС) в Россию, в настоящий момент невозможен до проведения соответствующих переговоров с Россельхознадзором относительно сертификата между ЕС и ЕврАзЭС.

Как следует из личных пояснений фермеров, привозимые из Европы кролики передаются заказчикам в неофициальных условиях, без надлежащего документального оформления (в том числе, финансовых документов), несмотря на то, что стоимость некоторых пород элитных кроликов может достигать 1000 евро за одну штуку.

Таким образом, есть основания полагать, что ЛПХ «Моряк» ввозит на территорию Российской Федерации животноводческую продукцию с сомнительным оформлением документов, без надлежащего оформления экспортных документов, что может быть расценено не только как контрабанда, но и угроза продовольственной безопасности в связи с ненадлежащим контролем за ввозом на территорию России сельскохозяйственных животных.

В этой связи прошу:

1. Поручить соответствующим службам провести тщательную проверку ЛПХ «Моряк», в ходе которой выявить объёмы поставок животных из-за рубежа, а также размер неуплаченных налогов в ходе такой деятельности;
2. Обеспечить надлежащий контроль за ввозом на территорию Российской Федерации сельскохозяйственных животных.

Отправил сюда http://www.genprok-urfo.ru/library/?cid=12

Прошу распространить:

P.S. Люди пишут:

Документов людям не дают при продаже.

С их сайта — «Все ввозимые кролики имеют племенные свидетельства, международные ветеринарные сертификаты, листы оценок, выставленных международными экспертами. Мы гарантируем покупателям приобретение здоровых животных».

Слова выше написанные Моряком-ЭТО ОБМАН ! Племенных свидетельств нет в Европе на кроликов. Формы ветеринарных сертификатов не согласованы между странами. Т.е. их здоровье не кто не может гарантировать.

Фрагмент переписки фермеров покупавших кроликов в ЛПХ Моряк:

Внимание, вопрос. Что вот уже пятнадцать лет ЛПХ Моряк дарит в будни и праздники сотрудникам Россельхознадзора?
Варианты 1) рубли, 2) доллары, 3) евро, 4) свой вариант.

UPD. Видеосвидетельства фермеров: http://zergulio.livejournal.com/4268546.html

О налогообложении личного подсобного хозяйства | ФНС России

Дата публикации: 15.07.2014 11:29 (архив)

В соответствии со ст. 2 Закона от 07.07.2003 № 112-ФЗ «О личном подсобном хозяйстве» личное подсобное хозяйство (далее – ЛПХ) — это форма непредпринимательской деятельности по производству и переработке сельскохозяйственной продукции. Личное подсобное хозяйство ведется гражданином и лицами, совместно проживающими с ним, в целях удовлетворения личных потребностей на земельном участке, предоставленном и (или) приобретенном для ведения ЛПХ. В п. 4 ст. 2 Федерального закона № 112-ФЗ особо оговаривается, что реализация гражданами, ведущими ЛПХ, сельскохозяйственной продукции, произведенной и переработанной при ведении личного подсобного хозяйства, не является предпринимательской деятельностью.

Налоговый кодекс Российской Федерации (далее НК РФ) предусматривает освобождение от налогообложения доходов, получаемых гражданами от реализации продукции, выращенной в ЛПХ. Так, в соответствии с п. 13 ст. 217 НК РФ не подлежат налогообложению (освобождаются от налогообложения) доходы налогоплательщиков, получаемые от продажи выращенной в ЛПХ продукции животноводства (как в живом виде, так и продуктов убоя в сыром или переработанном виде), продукции растениеводства (как в натуральном, так и в переработанном виде). При этом такие доходы освобождаются от обложения НДФЛ при одновременном соблюдении трех условий:

  1. общая площадь земельного участка (участков), который (которые) находится (одновременно находятся) на праве собственности и (или) ином праве у физических лиц, не превышает максимального размера, установленного в соответствии с п. 5 ст. 4 Федерального закона № 112-ФЗ;
  2. ведение налогоплательщиком ЛПХ должно осуществляться без привлечения наемных работников;
  3. налогоплательщик должен представить в налоговый орган документ, выданный соответствующим органом местного самоуправления (правлением садоводческого, огороднического или дачного некоммерческого объединения граждан), подтверждающий, что реализуемая продукция произведена в его ЛПХ.
В ситуации, когда большая часть или вся выращенная в ЛПХ продукция продается, сделки купли-продажи заключаются систематически, а в качестве покупателей выступают индивидуальные предприниматели или организации, инспекторы вполне могут посчитать деятельность предпринимательской. Если же гражданин — владелец ЛПХ еще и зарегистрирован в качестве индивидуального предпринимателя, то налоговые инспекторы практически всегда стараются доходы от продажи выращенной в ЛПХ сельхозпродукции включить в его доходы от предпринимательской деятельности.

Болезнь кроликов вызывает озабоченность у представителей дикой природы Южной Каролины

20 апреля 2021 г.

Биологи штата обеспокоены болезнью кроликов, которая в настоящее время распространена в западных штатах, но теперь также появилась во Флориде. (Фото дикой природы Южной Каролины, сделанное Тедом Боргом)


Должностные лица Департамента природных ресурсов Южной Каролины (SCDNR) обеспокоены кроличьей болезнью, которая поражает диких и домашних кроликов и почти всегда приводит к летальному исходу.

Вирус геморрагической болезни кроликов-2 (RHDV2) представляет собой высококонтагиозное заболевание, поражающее всех кроликов. К счастью, люди не восприимчивы к RHDV2, но они могут непреднамеренно распространять вирус.

«Это очень заразное заболевание, которое может сохраняться в окружающей среде в течение очень долгого времени», — сказал Майкл Хук, руководитель проекта по мелкой охоте в Департаменте природных ресурсов Южной Каролины (SCDNR). «Эти факторы делают усилия по борьбе с болезнями чрезвычайно сложными, когда речь идет о диких популяциях кроликов.”

Вспышка началась в 2020 году на юго-западе США и привела к гибели некоторых видов местных диких кроликов. Дикие кролики в питомниках и домашние кролики также могут подвергаться риску. RHDV2 был обнаружен в Аризоне, Калифорнии, Неваде, Нью-Мексико, Техасе, Юте, Вайоминге, Мексике и совсем недавно во Флориде.

Симптомы, проявляемые кроликами, инфицированными RHDV2, могут включать любые из следующих: потеря аппетита, вялость, высокая температура, судороги, желтуха, кровотечение из носа, рта или прямой кишки, затрудненное дыхание и внезапная смерть.

Вирус передается при прямом и непрямом контакте, по словам Хука. Прямой контакт происходит, когда кролик вступает в физический контакт с инфицированным кроликом или с мочой или фекалиями инфицированного кролика. Косвенный контакт происходит, когда кролик вступает в контакт с предметами, зараженными вирусом, включая одежду, которую носят люди, имевшие контакт с зараженными предметами или инфицированными кроликами. Также вирус может передаваться через продукты из кролика, такие как мех, мясо или шерсть.Также известно, что насекомые, птицы, грызуны, хищники и домашние животные распространяют RHDV2.

Крюк сказал, что больных или мертвых кроликов следует собирать или обрабатывать. Если вы нашли мертвого кролика в дикой природе или в бегущем вольере, пожалуйста, оставьте тушу и обратитесь к местному биологу SCDNR или сотруднику по охране природы. Если у вас есть больной или мертвый домашний кролик, отнесите его к местному ветеринару, который может отправить его в Ветеринарно-диагностический центр Клемсона для обследования.

«Ознакомление себя и других с RHDV2 — один из лучших способов защитить кроликов Южной Каролины», — сказал Хук.

Посетите https://www.clemson.edu/public/lph/ahp/species/rabbit.html для получения более подробной информации.

ВЛИЯНИЕ ИНГАЛЯЦИОННОГО ОЧИЩАЮЩЕГО СРЕДСТВА ЛПХ НА РАЗРУШЕНИЕ ЭРИТЦИТОВ КРОВИ У КРОЛИКОВ | Интернет-исследования в области здравоохранения и окружающей среды (HERO)

ID ГЕРОЯ

1805720

Тип ссылки

Журнальная статья

Заголовок

ВЛИЯНИЕ ИНГАЛЯЦИОННОГО ОЧИЩАЮЩЕГО СРЕДСТВА ЛПХ НА РАЗРУШЕНИЕ ЭРИТИКЕТОВ У КРОЛИКОВ

Авторы)

Чен Дж. Х.; Старший, Дж. М.; Шаффер, CL

Год

1973 г.

Рецензируется ли эксперт?

да

Журнал

Педиатрические исследования
ISSN: 0031-3998
EISSN: 1530-0447

Номер отчета

НЕЕП/74/05691

Объем

7

Проблема

4

Номера страниц

354-126

Абстрактный

АВТОРСКОЕ ПРАВО HEEP: БИОЛ АБС. РЕФЕРАТ ДЛЯ ЧЕЛОВЕКА НОВОРОЖДЕННЫЙ ОПАСНОСТЬ ДЛЯ ДОМАШНИХ РОЖДЕНИЙ D БЕНЗИЛ-P-ХЛОРФЕНОЛ P ТРЕТИЧНЫЙ АМИЛФЕНОЛ O ФЕНИЛФЕНОЛ

%PDF-1.6 % 1 0 объект >/OCGs[8 0 R]>>/Страницы 2 0 R/Тип/Каталог>> эндообъект 28 0 объект >/Шрифт>>>/Поля[]>> эндообъект 32 0 объект >поток 2022-02-09T12:20:13-08:002006-09-27T09:06:45-07:002022-02-09T12:20:13-08:00uuid:05ed16ca-683b-46c9-9521-59743fcc5eefuuid:a1de12f9- 1dd1-11b2-0a00-8100180397ffзаявка/pdf конечный поток эндообъект 2 0 объект > эндообъект 23 0 объект >/Ресурсы>/Шрифт>/T1_1>/T1_2>/T1_3 36 0 R>>/ProcSet[/PDF/Text/ImageB]/Properties>/XObject>>>/Type/Page>> эндообъект 18 0 объект >/Ресурсы>/Шрифт>/T1_1>/T1_2>/T1_3>/T1_4>/T1_5>/T1_6 36 0 R>>/ProcSet[/PDF/Text/ImageB]/Properties>/XObject>>>/Type/ Страница>> эндообъект 13 0 объект >/Ресурсы>/Шрифт>/T1_1>/T1_2>/T1_3>/T1_4 36 0 R>>/ProcSet[/PDF/Text/ImageB]/Properties>/XObject>>>/Type/Page>> эндообъект 5 0 объект >/Ресурсы>/Шрифт>/T1_1>/T1_2>/T1_3 36 0 R>>/ProcSet[/PDF/Text/ImageB]/Properties>/XObject>>>/Type/Page>> эндообъект 33 0 объект >/ProcSet[/PDF/Text/ImageC]/XObject>>>/Type/Page>> эндообъект 43 0 объект [50 0 Р 51 0 Р 52 0 Р 53 0 Р 54 0 Р] эндообъект 44 0 объект >поток д 540. 0594177 0 0 68,6011963 35,9702911 675,3988037 см /Im0 Делать Вопрос БТ /T1_0 1 тс 10 0 0 10 85,56995 576,99985 Тм (1978; 38:1568-1571.) /T1_1 1 тс -5,55699 0 тд (Рак Res\240)Tj /T1_0 1 тс 0 1 ТД (\240 )Tj 0 1.00001 ТД (М. Бурасса, Х. Шеррер, П. Д. Пецалла и др.) Tj /T1_2 1 тс 0 1 ТД (\240 )Tj /T1_3 1 тс 18 0 0 18 30 616,99997 Тм (Трансплантируемая опухоль \(MtT-F4\))Tj 8.49598 1 тд (-Эндорфин в маммотропе крыс)Tj /T1_4 1 тс -0,54899 0 тд (б)Tj /T1_3 1 тс -7,94699 0 тд (иммунореактивный)Tj ET 30 522 552 35 рэ 0 0 м С БТ /T1_0 1 тс 11 0 0 11 120.94202 529,99997 Тм (\240 )Tj /T1_3 1 тс -7,55696 1 тд (Обновленная версия)Tj ET БТ /T1_2 1 тс 10 0 0 10 141 521,99994 Тм (\240 )Tj /T1_0 1 тс 22,62295 1 тд ( )Tj 0 0 1 рг -22,62295 0 тд (http://cancerres.aacrjournals.org/content/38/6/1568)Tj 0 г 0 1.00001 ТД (Доступ к самой последней версии этой статьи на:)Tj ET БТ /T1_2 1 тс 10 0 0 10 30 501,99997 Тм (\240 )Tj 0 1 ТД (\240 )Tj ET БТ /T1_2 1 тс 10 0 0 10 30 481,99997 Тм (\240 )Tj Т* (\240 )Tj ET БТ /T1_2 1 тс 10 0 0 10 30 461,99997 Тм (\240 )Tj Т* (\240 )Tj ET 30 347 552 115 рэ 0 0 м С БТ /T1_0 1 тс 11 0 0 11 120. 94202 429,99997 Тм (\240 )Tj /T1_3 1 тс -5,66901 1 тд (Уведомления по электронной почте)Tj ET БТ /T1_0 1 тс 10 0 0 10 295,4996 442 Тм (относится к этой статье или журналу.)Tj 0 0 1 рг -15,44996 0 тд (Зарегистрируйтесь, чтобы получать бесплатные уведомления по электронной почте)Tj ET БТ 0 г /T1_0 1 тс 11 0 0 11 120,94202 396,99994 Тм (\240 )Tj /T1_3 1 тс -6,38997 1 тд (Подписки)Tj 0,556 1,00001 Тд (Перепечатки и) Tj ET БТ /T1_0 1 тс 10 0 0 10 141 399,99994 Тм (\240 )Tj 13.46496 1 тд (.)Tj 0 0 1 рг -6,85098 0 тд ([email protected]) Tj 0 г -6,61398 0 тд (Отдел в)Tj 0 1.00001 ТД (Чтобы заказать перепечатку этой статьи или подписаться на журнал, свяжитесь с\ t Публикации AACR)Tj ET БТ /T1_0 1 тс 11 0 0 11 120,94202 374,99997 Тм (\240 )Tj /T1_3 1 тс -5,66901 1 тд (Разрешения)Tj ET БТ /T1_0 1 тс 10 0 0 10 141 346,99988 Тм (\240 )Tj 0 1 ТД (сайт с правой ссылкой. )Tj 0 1.00001 ТД (Нажмите «Запросить разрешения», чтобы перейти к очистке авторских прав\ \(CCC\))Tj ранцевого центра 22,62295 1 тд (.)Tj 0 0 1 рг -22,62295 0 тд (http://cancerres. aacrjournals.org/content/38/6/1568)Tj 0 г 0 1 ТД (Чтобы запросить разрешение на повторное использование всей или части этой статьи, используйте этот li\ нк)Tj ET БТ /T1_0 1 тс 9 0 0 9 283.\q

антитело против РОМС | Кроличье поликлональное антитело к АКТГ-P01189.2

P01189.2
[Другие продукты]

Основной номер доступа UniProt

[Другие продукты]

Вторичный номер доступа UniProt

Связанный с UniProt номер доступа

Молекулярный вес

29 424 Да

Официальное полное имя NCBI

Проопиомеланокортин

Полные имена официальных синонимов NCBI

проопиомеланокортин

Официальные символы-синонимы NCBI

л/ч; МСХ; АЭС; ПОК; АКТГ; CLIP
  [Похожие товары]

Информация о белках NCBI

проопиомеланокортин; бета-ЛПХ; бета-МСГ; альфа-МСГ; гамма-ЛПХ; гамма-МСГ; бета-эндорфин; мет-энкефалин; липотропин бета; липотропин гамма; меланотропин бета; меланотропин альфа; меланотропин гамма; про-АКТГ-эндорфин; адренокортикотропин; кортикотропин-липотропин; адренокортикотропный гормон; препропептид опиомеланокортина; препропротеин проопиомеланокортина; бета-меланоцитостимулирующий гормон; альфа-меланоцитстимулирующий гормон; кортикотропиноподобный промежуточный пептид

Название белка UniProt

Проопиомеланокортин

UniProt Синоним Названия белков

Кортикотропин-липотропин Расщепляется на следующие 11 цепей: NPP; Меланотропин гаммаАльтернативное название(я):Гамма-МСХ

UniProt Synonym Gene Names

Имя записи UniProt

COLI_HUMAN

Сводка NCBI для POMC

Этот ген кодирует предшественник полипептидного гормона, который подвергается обширному тканеспецифичному посттрансляционному процессингу посредством расщепления субтилизиноподобными ферментами, известными как прогормонконвертазы. В полипептидном предшественнике имеется восемь потенциальных сайтов расщепления, и, в зависимости от типа ткани и доступных конвертаз, процессинг может дать до десяти биологически активных пептидов, участвующих в различных клеточных функциях. Кодируемый белок синтезируется главным образом в кортикотрофных клетках передней доли гипофиза, где используются четыре сайта расщепления; адренокортикотропин, необходимый для нормального стероидогенеза и поддержания нормальной массы надпочечников, и липотропин бета являются основными конечными продуктами.В других тканях, включая гипоталамус, плаценту и эпителий, могут использоваться все сайты расщепления, что приводит к образованию пептидов, играющих роль в болевом и энергетическом гомеостазе, стимуляции меланоцитов и иммуномодуляции. К ним относятся несколько различных меланотропинов, липотропинов и эндорфинов, которые содержатся в пептидах адренокортикотропина и бета-липотропина. Мутации в этом гене связаны с ранним началом ожирения, надпочечниковой недостаточностью и рыжей пигментацией волос. В качестве альтернативы были описаны сплайсированные варианты транскриптов, кодирующие один и тот же белок.[предоставлено RefSeq, июль 2008 г.]

Комментарии UniProt для POMC

POMC: АКТГ стимулирует надпочечники к высвобождению кортизола. Дефекты POMC могут быть связаны с предрасположенностью к ожирению (ОЖИРЕНИЕ). Это состояние, характеризующееся увеличением массы тела сверх ограничений скелета и физических потребностей в результате чрезмерного накопления жира в организме. Дефекты POMC являются причиной дефицита проопиомеланокортинина (POMCD). У пострадавших людей наблюдается раннее ожирение, надпочечниковая недостаточность и рыжие волосы.Относится к семейству POMC.

Тип белка: секретируемый; Секретируемый, сигнальный пептид

Хромосомная локализация человека Ортолог: 2p23.3

Клеточный компонент: внеклеточное пространство; пероксисомальный матрикс; цитоплазма; внеклеточная область; пероксисома; секреторная гранула

Молекулярная функция: связывание с меланокортиновым рецептором 3 типа; связывание с рецептором, сопряженным с G-белком; связывание рецептора меланокортина 4 типа; гормональная активность; связывание с рецептором

Биологический процесс: образование предшественников метаболитов и энергии; процесс метаболизма клеточных белков; передача сигналов между клетками; сигнальный путь нейропептида; регулирование артериального давления; процессинг пептидных гормонов; регулирование аппетита; позитивная регуляция транскрипции с промотора РНК-полимеразы II; негативная регуляция продукции фактора некроза опухоли; гомеостаз глюкозы; передача сигнала; клеточная пигментация

Болезни: Ожирение; Дефицит проопиомеланокортина

Меры предосторожности

Все продукты MyBioSource предназначены для научных лабораторных исследований и не предназначены для диагностики, терапии, профилактики или использования in vivo. Покупая, вы прямо заявляете и гарантируете MyBioSource, что будете должным образом тестировать и использовать любые Продукты, приобретенные у MyBioSource, в соответствии с отраслевыми стандартами. MyBioSource и его авторизованные дистрибьюторы оставляют за собой право отказать в обработке любого заказа, если мы обоснованно считаем, что предполагаемое использование выходит за рамки наших приемлемых правил.

Отказ от ответственности

Несмотря на то, что были предприняты все усилия для обеспечения точности информации, представленной в этом листе данных, MyBioSource не несет ответственности за какие-либо упущения или ошибки, содержащиеся в нем.MyBioSource оставляет за собой право вносить изменения в данное техническое описание в любое время без предварительного уведомления.

Клиент обязан сообщить MyBioSource о проблемах с производительностью продукта в течение 30 дней с момента получения продукта. Пожалуйста, посетите нашу страницу «Условия и положения» для получения дополнительной информации.

Продукты, связанные с антителом против РОМС
Пути, связанные с антителом против РОМС
Заболевания, связанные с антителом против РОМС
Органы/ткани, ассоциированные с антителом против РОМС

Применение, побочные эффекты, взаимодействие, дозировка / таблетка

ПРЕДУПРЕЖДЕНИЯ

Только для местного офтальмологического применения.Не для инъекций или перорального применения.

МЕРЫ ПРЕДОСТОРОЖНОСТИ

См. раздел ИНФОРМАЦИЯ ДЛЯ ПАЦИЕНТОВ .

Канцерогенез, мутагенез, нарушение репродуктивной функции Клетки китайского хомячка V79, микроядерный анализ in vivo у мышей и доминантный летальный тест на мышах.

Лечение самцов крыс пероральными дозами кетотифена ≥ 10 мг/кг/день перорально [в 6667 раз превышает максимальную рекомендуемую глазную дозу для человека 0,0015 мг/кг/день в пересчете на мг/кг (MRHOD)] в течение 70 дней до спаривания привело к смертности и снижению рождаемости. Лечение кетотифеном не ухудшало фертильность у самок крыс, получавших до 50 мг/кг/день кетотифена перорально (в 33 333 раза больше MRHOD) в течение 15 дней до спаривания.

Беременность

Беременность Категория C

Пероральное лечение беременных кроликов во время органогенеза 45 мг/кг/день кетотифена (в 30 000 раз больше MRHOD) приводило к увеличениюОднако никаких эффектов не наблюдалось у кроликов, получавших до 15 мг/кг/день (в 10 000 раз больше MRHOD). Аналогичное лечение крыс во время органогенеза кетотифеном в дозе 100 мг/кг/день (в 66 667 раз больше MRHOD) не выявило каких-либо биологически значимых эффектов.

Пероральное лечение беременных крыс (до 100 мг/кг/день или в 66 667 раз больше MRHOD) и кроликов (до 45 мг/кг/день или в 30 000 раз больше MRHOD) во время органогенеза не приводило к какой-либо биологически значимой эмбриофетальной токсичности . У потомства крыс, получавших кетотифен перорально с 15-го дня беременности до 21-го дня после родов в дозе 50 мг/кг/день (в 33 333 раза больше MRHOD), протокол лечения, токсичный для матери, частота постнатальной смертности была немного выше, а Прибавка массы тела в течение первых четырех дней после родов была несколько снижена.

Кормящие матери

Кетотифен фумарат был обнаружен в грудном молоке крыс после перорального введения. Неизвестно, может ли местное введение в глаза привести к достаточной системной абсорбции для образования обнаруживаемых количеств в грудном молоке. Тем не менее следует соблюдать осторожность при назначении кетотифена фумарата кормящей матери.

Использование в педиатрии

Безопасность и эффективность у детей в возрасте до 3 лет не установлены.

Нокаут гена Mpv17-подобного белка (M-LPH) в клетках гепатомы человека приводит к нарушению целостности мтДНК за счет снижения уровня TFAM, OGG1 и LIG3 на уровне белка

Mpv17-подобный белок человека (M-LPH) имеет было предложено участвовать в предотвращении митохондриальной дисфункции, вызванной повреждением митохондриальной ДНК (мтДНК). Чтобы прояснить молекулярный механизм функции M-LPH, мы нокаутировали M-LPH в гепатоме человека HepG2 с использованием технологии CRISPR-Cas9. Увеличение повреждения мтДНК в клетках M-LPH-KO HepG2 было продемонстрировано с помощью количественного анализа на основе ПЦР и измерения 8-гидрокси-2-дезоксигуанозина (8-OHdG). Кроме того, конфокальный иммунофлуоресцентный анализ и вестерн-блоттинг митохондриальных экстрактов показали, что M-LPH-KO вызывает снижение уровня белка митохондриального фактора транскрипции A (TFAM), важного фактора для транскрипции и поддержания мтДНК, и двух ферментов репарации ДНК, 8-оксогуанин ДНК-гликозилаза (OGG1) и ДНК-лигаза 3 (LIG3), обе участвуют в эксцизионной репарации митохондриальных оснований (BER). Соответственно, было высказано предположение, что увеличение повреждения мтДНК было связано с кумулятивным эффектом нестабильности мтДНК в результате дефицита TFAM и сниженной способности к BER, возникающей из-за дефицита ферментов, связанных с BER.Эти данные свидетельствуют о том, что M-LPH может участвовать в поддержании мтДНК и, следовательно, митохондриальной функции, защищая белки, необходимые для стабильности и поддержания мтДНК комплексным образом.

1. Введение

Митохондрии являются жизненно важными органеллами в эукариотических клетках, участвующими в основных функциях, таких как производство энергии посредством окислительного фосфорилирования (OXPHOS), поддержание гомеостаза кальция, регуляция апоптоза и некроза, метаболизм липидов и иммунные реакции [1]. Митохондрии обладают собственной двухцепочечной кольцевой ДНК (мтДНК), которая кодирует 22 тРНК, 2 рРНК и 13 субъединиц комплексов OXPHOS. Из-за постоянной атаки активных форм кислорода (АФК), генерируемых как побочные продукты окислительного метаболизма, мтДНК имеет гораздо более высокую частоту мутаций, чем ядерная ДНК (яДНК) [2-4]. мтДНК организована в виде ДНК-белковых комплексов, называемых нуклеоидами, которые ковалентно связаны с внутренней митохондриальной мембраной [5], и более 50 нуклеоид-ассоциированных белков играют роль в поддержании мтДНК и экспрессии генов [6].Митохондриальный транскрипционный фактор А (TFAM), член семейства белков группы высокой подвижности (HMG)-box, является одним из основных компонентов нуклеоидов. TFAM играет существенную роль в транскрипции и поддержании мтДНК и упаковывает мтДНК путем неспецифического связывания и мультимеризации [7, 8], тем самым защищая мтДНК от повреждения АФК [9, 10]. В то же время было обнаружено, что митохондрии обладают несколькими системами репарации, в том числе базовой эксцизионной репарацией (BER), репарацией несоответствия и прямой реверсией [11]. Механизм BER в митохондриях аналогичен таковому в ядре, и многие ферменты BER, работающие в ядре, включая 8-оксогуанин-ДНК-гликозилазу (OGG1) и ДНК-лигазу 3 (LIG3), также идентифицированы в митохондриях. Имеются данные о том, что белки BER в митохондриях локализованы на внутренней мембране и, следовательно, на нуклеоиде [12]. Однако детали механизма регуляции этих белков, участвующих в поддержании целостности мтДНК, до конца не изучены.

Mpv17-подобный белок (M-LP, синоним: Mpv17L) принадлежит к семейству белков Mpv17/PMP22.Первоначально М-ЛП был идентифицирован как продукт возрастно-экспрессируемого гена в почках мышей [13-15], а впоследствии был идентифицирован человеческий ортолог М-ЛП (М-ЛПХ) [16]. Экспрессия гена M-LPH регулируется репрессором транскрипции, ZNF205/RhitH (humanregulator of термоиндуцированная транскрипция) [17, 18], а экспрессия гена ZNF205/RhitH , в свою очередь, регулируется ГА-связывающий белок, один из ключевых регуляторов транскрипции митохондриальной системы транспорта электронов [19]. Недавние эксперименты по коиммунопреципитации показали, что M-LPH взаимодействует с семейством гистонов h3A, членом X (h3AX), рибосомным белком S14, рибосомным белком S3 и белком 31, ассоциированным с В-клеточным рецептором [20]. Известно, что эти белки тесно связаны с реакцией на повреждение ДНК, стрессом эндоплазматического ретикулума, репарацией ДНК, апоптозом или делением митохондрий. Хотя молекулярная функция M-LPH не была выяснена, ряд наших результатов, полученных к настоящему времени, убедительно свидетельствует о том, что M-LPH участвует в поддержании мтДНК, поэтому защищает клетки от митохондриальной дисфункции: (i) сверхэкспрессия M-LPH в клетках рака молочной железы MCF-7 уменьшает образование внутриклеточных АФК и потерю потенциала митохондриальной мембраны (19), вызванную ингибитором дыхательной цепи [19].(ii) Нокдаун M-LPH в нормальных клетках почек HK-2 приводит к увеличению повреждения мтДНК и снижению экспрессии генов, кодируемых мтДНК [20]. (iii) В клетках HK-2 M-LPH совместно локализуется с митохондриальными ферментами BER, LIG3 и ДНК-полимеразой γ при окислительном стрессе [20]. Чтобы прояснить молекулярный механизм функции M-LPH, мы сначала попытались создать клетки HK-2 с нокаутом M-LPH (KO) с использованием технологии CRISPR-Cas9. Однако все полученные одноклеточные клоны не пролиферировали и постепенно погибали в течение двух месяцев, что указывает на возможность того, что нокаут гена M-LPH был летальным для клеток HK-2.Затем мы выбрали клетки гепатомы HepG2, которые экспрессируют умеренный уровень M-LPH и успешно нокаутировали M-LPH в клетках HepG2. В настоящем исследовании мы подтвердили, что отсутствие M-LPH приводит к увеличению повреждения мтДНК. Кроме того, мы обнаружили, что M-LPH-KO приводит к снижению митохондриального TFAM, OGG1 и LIG3 на уровне белка. Эти наблюдения позволили предположить, что повышенная степень повреждения мтДНК в клетках с дефицитом M-LPH была связана с кумулятивным действием двух факторов: нестабильностью мтДНК из-за отсутствия TFAM и снижением способности к восстановлению повреждений мтДНК из-за отсутствия ферментов BER.

2.
Материалы и методы
2.1. Клетки

Линия клеток гепатомы человека HepG2 была получена из Японской коллекции исследовательских банков биоресурсов (JCRB, Осака, Япония). Клетки поддерживали в среде EMEM с добавлением 10% фетальной телячьей сыворотки, 0,29 мг/мл L-глютамина, 0,11 мг/мл пирувата натрия, 0,1 мМ заменимых аминокислот и 1,5 мг/мл бикарбоната натрия в атмосфере 5% СО 2 при 37°С.

2.2. CRISPR/Cas9-опосредованный нокаут M-LPH

Последовательности CRISPR, нацеленные на экзон 1 человеческого гена M-LPH , были сконструированы с использованием инструмента проектирования CRISPR (http://crispr.mit.edu/), и были синтезированы соответствующие олигонуклеотиды: 5-CACCCGAGCCGTAAAGCAGCACGT-3 и 5-AAACACGTGCTGCTTTACGGCTCG-3. Пару олигонуклеотидов, кодирующих направляющие последовательности из 20 нуклеотидов, отжигали и клонировали в сайты Bbs I pX459 (ID плазмиды Addgene: 48139) и трансфицировали в клетки HepG2 с использованием липофектамина 3000 (Invitrogen, Carlsbad, CA). Трансфицированные клетки отбирали с помощью 1,5  мкг/мл мкг/мл пуромицина. Одноклеточные клоны оценивали на наличие вставок/делеций (инделей) в целевом локусе с использованием набора для обнаружения мутаций Surveyor (Integrated DNA Technologies Inc., Коралвилль, Айова). Затем геномную область, включающую целевой локус, подвергали ПЦР-амплификации, а полученные продукты ПЦР субклонировали в вектор pCR2.1 (Invitrogen) и секвенировали для подтверждения наличия инделей в целевой последовательности каждого аллеля. Наконец, устранение экспрессии M-LPH на уровне белка было подтверждено вестерн-блоттингом.

2.3. Анализ клеточного роста

Для измерения способности к пролиферации клеток M-LPH-дикого типа (WT) и -KO 6,7 × 10 4 клеток высевали на 12-луночные планшеты (каждый), а затем инкубировали в течение 24, 48 , и 72 часа.Количество клеток определяли с помощью гемоцитометра, а время удвоения клеток рассчитывали с использованием программного обеспечения, доступного в Интернете (http://www. doubling-time.com/compute.php).

2.4. Оценка повреждения мтДНК

Митохондрии выделяли из клеток M-LPH-WT и -KO с использованием набора для выделения митохондрий (Thermo Scientific, Waltham, MA). Выделение мтДНК проводили по методу, описанному Goo et al. [21]. Оценку повреждения мтДНК проводили с помощью количественной ПЦР (Q-PCR), как описано ранее [20, 22].Два набора праймеров предназначались для последовательностей, кодирующих АТФ-синтазу 6 (MTATP6) и АТФ-синтазу 8 (MTATP8), оба из которых локализованы в горячих регионах, чувствительных к свободнорадикальной атаке [23], и были сконструированы еще два набора праймеров. для областей D-петли (позиции 368–476 и 16 457–16 535 NC_012920), где редко наблюдаются поражения. Степень повреждения мтДНК рассчитывали путем деления относительного значения продукта ПЦР на значение, амплифицированное из митохондриально кодируемой области 16S РНК ( MTRNR2 ), где повреждения наблюдаются редко [22].Все последовательности грунтовки, используемые в этом исследовании, суммированы в таблице 1.


+
GTAGTATGGGAGTGGGAGGGGA TTTAAGGGGAACGTGTGGGC CGACGTAGAAGATCCTTTCGTCCAA AAAGCGGTTCTTGGACACCT CGACCAAAGACAACCAGGTC TGGGGTAACTCTGCCAACA

8

Dene / Region Forward Primer (5-3) Reverse Primer (5-3)
D-петли
368-476 ACCCTAACACCAGCCTAACCA
16,457-16,535 GCCCATAACACTTGGGGGTA
TFAM GCTTGGAAAACCAAAAAGACCTCGT
TWNK AGCCAAAGCAAGCCAGGAA
SDHA ACCAACTACAAGGGGCAGGT
COX7B AGCCACCAGAAACGTACACC
ATP50 CGTTTCTCTCTTCCCACTCG 9 0096 GTGGCATAGCGACCTTCAAT

siRNA-опосредованный нокдаун M-LPH проводили, как описано ранее [19]. Клетки M-LPH-WT трансфицировали контрольной миРНК или миРНК для нокдауна M-LPH соответственно.

2.5. Q-PCR Analysis

Тотальную РНК экстрагировали с помощью набора RNeasy Mini (Qiagen, Chatsworth, CA), а кДНК синтезировали с использованием набора реагентов PrimeScript RT с gDNA Eraser (Takara, Bio Inc., Shiga, Japan). Q-ПЦР проводили с использованием системы ПЦР в реальном времени StepOnePlus (Applied Biosystems, Фостер-Сити, Калифорния) и Power SYBR Green Master Mix (Applied Biosystems) в соответствии с инструкциями производителя.Для оценки уровней мРНК на одну клетку экспрессию каждого гена нормализовали относительно экспрессии β -актина, тогда как уровни на одну молекулу мтДНК оценивали путем нормализации относительно экспрессии MTRNR2. Измерение транскриптов, кодирующих митохондриальную форму OGG1 и LIG3, проводили с использованием праймеров, приобретенных у Qiagen (OGG1, QT01863330; LIG3 и QT00017115). Содержание мтДНК определяли с помощью зонда TaqMan, специфичного к области тРНК leu , а в качестве ядерного гена для нормализации использовали β 2-микроглобулин в соответствии с предыдущей работой [24]. Все ПЦР-анализы проводили не менее трех раз.

2.6. Измерение митохондриального уровня, уровня АФК, уровня АТФ и уровня 8-гидрокси-2-дезоксигуанозина (8-OHdG)

Потери митохондрий отслеживали с использованием набора для анализа потенциала митохондриальной мембраны Cell Meter JC-10 (AAT Bioquest, Саннивейл, Калифорния). ). Клетки M-LPH-WT и -KO выращивали в 96-луночных планшетах (каждый) и окрашивали флуоресцентным катионным красителем JC-10 в соответствии с инструкциями производителя. Интенсивность флуоресценции мономерных форм и агрегатов JC-10 контролировали на устройстве для считывания микропланшетов SpectraMax M5 (Molecular Device, Sunnyvale, CA).Соотношение интенсивностей флуоресценции при Em 538/590 использовали для анализа данных.

Уровни внутриклеточных АФК оценивали методом флуоресценции 2,7-дихлорфлуоресцеиндиацетата (DCF-DA) [25]. Вкратце, клетки M-LPH-WT и -KO выращивали в чашках диаметром 60 мм до 70–80% слияния (каждая) и инкубировали с 10  мкМ М DCF-DA в течение 1 часа. Затем клетки дважды промывали PBS и обрабатывали ультразвуком с использованием Bioruptor UCD-200 (Diagenode, Seraing, Бельгия) с 10 вспышками по 10 с в бане с ледяной водой.Затем собирали клеточный лизат и сразу же измеряли флуоресценцию DCF в 96-луночном планшете при . Уровни внутриклеточных АФК также измеряли путем окрашивания MitoSOX Red (Invitrogen). Клетки M-LPH-WT и -KO выращивали в 6-луночных планшетах до 70–80% слияния и инкубировали с 5  мкМ M MitoSOX в течение 15 мин. Затем клетки обрабатывали трипсином, промывали PBS, содержащим 0,1% BSA, суспендировали в 500  мкл мкл PBS, содержащего 0,01% BSA, и анализировали с использованием флуоресцентно-активируемого сортировщика клеток BD FACSCanto II (BD Biosciences, Сан-Хосе, Калифорния). .MitoSOX Red подвергали воздействию лазерного излучения с длиной волны 488 нм, а данные собирали по каналу 585/42 нм (FL2).

Уровни внутриклеточного АТФ измеряли с использованием набора для анализа внутриклеточного АТФ (TOYO B-Net, Токио, Япония) в соответствии с инструкциями производителя. Вкратце, одинаковое количество клеток M-LPH-WT и -KO (каждого) лизировали добавлением реагента для экстракции АТФ (1,5 × 10 3 клеток на 150  мкл л). После центрифугирования 100  мкл мкл супернатанта и 100  мкл мкл реагента для обнаружения АТФ смешивали вместе в темноте.Люминесценцию измеряли с помощью ридера для микропланшетов. Уровни АТФ определяли с использованием стандартной кривой, построенной по известным количествам АТФ.

Для измерения 8-OHdG общую ДНК экстрагировали из клеток M-LPH-WT и -KO с использованием набора QIAamp DNA Mini Kit (Qiagen). Уровни 8-OHdG в образцах ДНК определяли с использованием набора ELISA OxiSelect Oxidative DNA Damage (Cell Biolabs Inc., Сан-Диего, Калифорния) в соответствии с инструкциями производителя.

2.7. Вестерн-блот-анализ

Ядерные и митохондриальные экстракты готовили с использованием набора для фракционирования субклеточных белков для культивируемых клеток (Thermo Scientific).Электрофорез в SDS-PAGE и вестерн-блоттинг проводили, как описано ранее [26], с использованием антител против M-LPH (HPA041180) и против LIG3 (HPA006723), приобретенных у Atlas Antibodies (Стокгольм, Швеция), против зависимого от напряжения анионного канала. (VDAC, 55249-1-AP), анти-гистоновая деацетилаза 1 (HDAC1, 10197-1-AP), анти-гистоновый кластер 1, член семейства h2 C (HIST1h2C, 15446-1-AP), и анти-Lon протеаза- антитела к белку (LONP1, 15440-1-AP) от Proteintech (Чикаго, Иллинойс), антитела к TFAM (#8076) и к ДНК-полимеразе γ , антитела к каталитической субъединице (POLG, #13609) от Cell Signaling Technology ( Дэнверс, Массачусетс), антитело против OGG1 (NB100-106) от Novus Biologicals (Литлтон, Колорадо), член класса 1 семейства белков 90 альфа против теплового шока (HSP90AA1, GTX109753) и член семейства гистонов против гамма-h3A X ( γ -h3AX, GTX11174) антитела от GeneTex (Ирвин, Калифорния), антитела против геликазы Twinkle (TWNK, ab83329) от Abcam (Кембридж, Великобритания) и анти- β -acti n-антитело (A2066) от Sigma (St.Луи, Миссури). Антитела IgG кролика, конъюгированные с пероксидазой хрена, были приобретены у Thermo Scientific. Относительные уровни экспрессии каждого белка количественно определяли денситометрическим измерением. Профили геля были получены с помощью программного обеспечения Multi Gauge (Fujifilm, Токио, Япония). Для изучения статуса фосфорилирования митохондриальных белков мы провели Zn 2+ -Phos-tag SDS-PAGE [27]. Гели Zn 2+ -Phos-tag (8% полиакриламид, 50  мк M Phos-tag) готовили по инструкции производителя (Wako Pure Chemical Industries, Осака, Япония) и проводили электрофорез при постоянном токе 30 мА в течение 80 мин (рабочий буфер: 0.1 М трис, 0,1 М MOPS, 0,1% ( w / v ) SDS и 0,05 M бисульфита натрия, pH 7,8). Для обработки протеинфосфатазой λ митохондриальные экстракты из клеток M-LPH-WT и -KO инкубировали с 40 U/ мкл мкл протеинфосфатазы λ или без нее (New England Biolabs, Ipswich, MA). Вестерн-блоттинг с использованием гелей Zn 2+ -Phos-tag проводили таким же образом, за исключением того, что гели трижды пропитывали по 10 мин в буфере для блоттинга, содержащем 10 мМ ЭДТА, перед переносом на мембрану из ПВДФ.

2.8. Анализ колокализации

Клетки M-LPH-WT и -KO выращивали в течение 1 дня на покровных стеклах, покрытых коллагеном I (Asahi Glass, Токио, Япония). Для окрашивания митохондрий клетки обрабатывали 300 нМ красителя MitoTracker (CMXRos, Molecular Probes, Eugene, OR) в культуральной среде в течение 30 минут при 37 °C. После промывания PBS клетки фиксировали 4% параформальдегидом в PBS в течение 15 минут, пермеабилизировали 0,5% раствором Triton X-100 в PBS в течение 5 минут, а затем обрабатывали блокирующим реагентом (усилитель сигнала Image-iT FX, Molecular Probes, Юджин, Орегон) в течение 30 мин.Клетки подвергали иммуноокрашиванию с использованием антител против TFAM, TWNK и γ -h3AX, а также вторичных антител, соответствующих каждому первичному антителу (Alexa Fluor 488 плюс козьи антикроличьи и Alexa Fluor 647 плюс козьи антимышиные антитела, Molecular Probes). Антитела разводили в разбавителях антител (Dako, Glostrup, Дания) и инкубировали с клетками в течение ночи при 4°C. Наконец, клетки помещали в реагент против выцветания (SlowFade Diamond Antifade Mountant с DAPI, Molecular Probes) и флуоресцентные изображения анализировали с помощью лазерного сканирующего конфокального микроскопа (FV1200, Olympus, Токио, Япония).

2.9. Статистический анализ

Все анализы были выполнены не менее 3 раз, и результаты были представлены как . Статистический анализ был выполнен с помощью критерия Стьюдента при уровне значимости .

3. Результаты
3.1. Генерация клеток M-LPH-KO с использованием системы CRISPR/Cas9

Мы разработали sgRNA, нацеленную на 20 пар оснований в экзоне 1 гена M-LPH , как показано на рисунке 1(a), и трансфицировали gRNA- Вектор экспрессии Cas9 в клетки HepG2.Два одноклеточных клона были созданы серийными разведениями в присутствии пуромицина, а вставки в области-мишени каждого аллеля были подтверждены анализом секвенирования (рис. 1(b) и 1(c)). Клон 1 был гетерозиготен по одной вставке T и одной G, тогда как клон 2 был гомозиготен по одной вставке T. Наконец, отсутствие белка M-LPH было подтверждено вестерн-блоттингом (рис. 1(d)). Далее показаны репрезентативные результаты, полученные с использованием клона 1, поскольку серия экспериментов с использованием обоих клонов дала аналогичные результаты.

3.2. Субклеточная локализация M-LPH в клетках HepG2

В нашем предыдущем исследовании с использованием клеток HK-2 мы обнаружили, что M-LPH был локализован преимущественно в ядре, в некоторой степени в митохондриях и незначительно в цитозоле. Чтобы изучить локализацию M-LPH в клетках HepG2, мы провели конфокальный иммунофлуоресцентный анализ и субклеточное фракционирование с последующим иммуноблоттинговым анализом . Антитело против M-LPH выявило слабое ядерное и цитозольное окрашивание, а в цитоплазме наблюдалось небольшое количество очагов точечного окрашивания.Все эти очаги были локализованы вместе с подмножеством митохондрий, как показано с помощью контрастного окрашивания MitoTracker, что указывает на то, что M-LPH локализован в митохондриях (рис. 2(а)). Дальнейшее исследование с использованием субклеточного фракционирования показало, что M-LPH умеренно локализовался в экстракте мембраны и немного в ядерном и цитозольном экстрактах (рис. 2(b)), что согласуется с результатами экспериментов по иммунофлуоресценции.

3.3. M-LPH-KO снижает скорость роста клеток HepG2

Чтобы установить, оказывает ли M-LPH-KO физиологический эффект на функцию клеток HepG2, мы сначала проанализировали скорость роста клеток M-LPH-WT и -KO.Как показано на рисунке 3, скорость роста клеток M-LPH-KO была значительно ниже, чем скорость роста клеток M-LPH-WT. Время удвоения для клеток M-LPH-WT и M-LPH-KO составило 31,8 ± 4,33 и 63,2 ± 9,84 ч соответственно ().


3.4. M-LPH-KO увеличивает уровень повреждения ядерной и митохондриальной ДНК

Чтобы выяснить, связано ли снижение роста клеток с повреждением ДНК, мы проанализировали экспрессию γ -h3AX, чувствительного маркера повреждения ядерной ДНК. и восстановление с использованием иммунофлуоресцентной микроскопии и вестерн-блоттинга. Количество очагов γ -h3AX было значительно увеличено с помощью M-LPH-KO (рис. 2(c)), и гораздо большее количество белка γ -h3AX было обнаружено в ядерных экстрактах, полученных из клеток M-LPH-KO. (Рисунок 2(г)). Эти результаты ясно показали, что повреждение яДНК произошло в клетках M-LPH-KO.

Затем мы изучили повреждение мтДНК путем количественной оценки относительного количества продукта ПЦР, амплифицированного из 4 областей мтДНК: двух горячих областей, чувствительных к атаке свободных радикалов ( MTATP6 , MTATP8 ) и двух областей D-петли, где повреждение редко наблюдаемый.Количество продуктов ПЦР, амплифицированных из областей MTATP6 и MTATP8 , было значительно снижено в клетках M-LPH-KO, тогда как в клетках, амплифицированных из областей D-петли, снижения не наблюдалось (рис. 4(a)). Для дальнейшего подтверждения этих результатов мы провели эксперименты по нокдауну M-LPH (KD) в клетках M-LPH-WT, а затем исследовали повреждение мтДНК (рис. 4(b)). Как и ожидалось, уровни повреждения мтДНК увеличивались под действием M-LPH-KD. В совокупности было высказано предположение, что уровни повреждения горячих областей мтДНК в нормальных условиях увеличивались под действием M-LPH-KO; то есть оказалось вероятным, что M-LPH ослаблял повреждение мтДНК, индуцированное АФК, которые постоянно генерируются в результате аэробного дыхания.Впоследствии мы оценили внутриклеточный уровень 8-OHdG, одного из основных повреждений ДНК, образовавшихся в результате окислительной атаки, и обнаружили, что он значительно повышен в клетках M-LPH-KO (рис. 5). Учитывая, что мтДНК является первичной клеточной мишенью для АФК и что уровень 8-OHdG в мтДНК значительно выше (в 3–16 раз), чем в яДНК [28], повышение уровня 8-OHdG в M-LPH Выявлено, что клетки -KO в основном связаны с окислительным повреждением мтДНК.


3.5. Отсутствие явных признаков митохондриальной дисфункции в клетках M-LPH-KO

Результаты нашего предыдущего исследования M-LPH-KD с использованием клеток нормальной почки человека (HK-2) показали высокую вероятность того, что повышенное повреждение мтДНК, наблюдаемое в клетках мтДНК -кодируемые гены приведут к снижению уровня их мРНК. Поэтому мы исследовали уровни мРНК этих генов, а также несколько генов, кодируемых яДНК, участвующих в OXPHOS. Неожиданно результаты анализа Q-PCR показали, что M-LPH-KO не вызывает снижения внутриклеточных уровней мРНК для всех исследованных генов (рис. 6(а)). Чтобы дополнительно изучить влияние MLPH-KO на функцию митохондрий, мы затем проанализировали внутриклеточные уровни АФК и АТФ и митохондрии (рис. 7). Это не выявило существенных различий между клетками M-LPH-WT и -KO ни в одном из проведенных анализов, что позволяет предположить, что митохондриальная функция M-LPH-KO не была нарушена, по крайней мере, в нормальных условиях.

3.6. M-LPH-KO увеличивает число копий мтДНК

Два наблюдения за клетками M-LPH-KO противоречат друг другу: увеличение повреждения мтДНК (рис. 4(a) и 5) и отсутствие митохондриальной дисфункции (рис. 6). (а) и 7). В качестве одного из возможных объяснений этого противоречия мы посчитали, что митохондриальная дисфункция, вызванная повреждением мтДНК, может быть предотвращена увеличением числа копий мтДНК, поскольку ряд исследований продемонстрировал эффективность увеличения числа копий мтДНК для сохранения митохондриальной функции [29]. , 30].Как мы и ожидали, количественная оценка мтДНК с помощью Q-PCR выявила увеличение числа копий на 66% в клетках M-LPH-KO по сравнению с таковым в клетках M-LPH-WT (рис. 8). Соответственно, уровни внутриклеточной мРНК (т. е. уровни мРНК на одну клетку), показанные на рисунке 6 (а), по-видимому, отражают увеличение числа копий мтДНК в клетках M-LPH-KO HepG2. Более того, когда мы оценили уровни мРНК на одну молекулу мтДНК путем нормализации не β -актина, а экспрессии MTRNR2, было обнаружено, что экспрессия всех генов, связанных с OXPHOS, снижается под действием M-LPH-KO (рис. 6(b)) .Взятые вместе, эти результаты убедительно свидетельствуют о том, что митохондриальная дисфункция из-за повреждения мтДНК предотвращается увеличением числа копий мтДНК, вероятно, посредством компенсаторного механизма в клетках HepG2.


3.7. M-LPH-KO изменяет внутримитохондриальные уровни белков TFAM, OGG1, LIG3 и TWNK

Чтобы исследовать молекулярный механизм, ответственный за увеличение повреждения и числа копий мтДНК, мы исследовали внутримитохондриальные уровни белков, необходимых для мтДНК. стабильность и обслуживание.Интересно, что M-LPH-KO приводил к очевидному снижению уровней белка TFAM, LIG3 и OGG1 и увеличению уровня TWNK (рис. 9(а)). Изменения уровней TFAM и TWNK в клетках M-LPH-KO также подтверждались конфокальной иммунофлуоресценцией (рис. 2(e) и 2(f)). Чтобы выяснить, происходит ли эта регуляция на уровне белка или РНК, мы исследовали соответствующие уровни экспрессии мРНК. Как показано на рисунке 10, уровни мРНК TFAM и TWNK, которые являются важными компонентами митохондриальной транскрипции и репликации, были значительно повышены, тогда как уровни LIG3 были снижены, хотя степень снижения на уровне белка (прибл.60 %), значительно выше, чем на уровне мРНК (23,4 %). С другой стороны, уровень мРНК OGG1 не изменился. Соответственно, по крайней мере, в отношении TFAM, LIG3 и OGG1 оказалось, что все снижения были связаны с посттрансляционной регуляцией, тогда как TWNK повышалась как на уровне мРНК, так и на уровне белка.


Известно, что TFAM регулируется посредством селективного протеолиза с помощью LONP1, основной протеазы, участвующей в контроле качества белков в митохондриях. Хорошо известно, что уровни белков LONP1 и TFAM демонстрируют сильную обратную корреляцию [31].Однако в экспериментальных условиях, которые мы использовали, мы заметили, что снижение TFAM не было связано с активацией LONP1, поскольку его уровень не изменился под действием M-LPH-KO (рис. 9 (а)). Другим возможным объяснением снижения TFAM является то, что M-LPH-KO усиливает фосфорилирование TFAM, поскольку было высказано предположение, что фосфорилирование ухудшает связывание TFAM с мтДНК и что TFAM без ДНК избирательно расщепляется LONP1 [31]. Чтобы исследовать состояние фосфорилирования TFAM, мы провели вестерн-блот-анализ с использованием гелей Zn 2+ -Phos-tag.На гелях Zn 2+ -Phos-tag значения Rf для всех фосфорилированных белков меньше, чем для соответствующих дефосфорилированных белков [27]. Как мы и ожидали, значение Rf для полосы TFAM в клетках M-LPH-KO было меньше, чем в клетках M-LPH-WT (рис. 9(b)). Кроме того, обработка протеинфосфатазой λ увеличивала подвижность TFAM в клетках M-LPH KO, тогда как подвижность клеток M-LPH-WT не изменялась (рис. 9(c)). Поэтому было высказано предположение, что на статус фосфорилирования TFAM влияет дефицит M-LPH (фосфорилирование стимулируется).

4. Обсуждение

TFAM представляет собой кодируемый ядром белок семейства HMG и наиболее распространенный компонент митохондриальных нуклеоидов. TFAM играет важную роль в транскрипции, репликации, упаковке и организации мтДНК. В нормальных условиях на одну молекулу мтДНК приходится ~1000 молекул TFAM, таким образом, полностью покрывая мтДНК и увеличивая гибкость, способствуя уплотнению [31]. Мутации в этом гене связаны с синдромом истощения мтДНК [32], а лечение TFAM в качестве экспериментальной терапии болезни Паркинсона было предложено на основании данных клеточной модели [33].Широко сообщалось, что KD или KO TFAM уменьшают количество копий мтДНК и что количества TFAM и мтДНК сильно коррелируют [10, 34]. Основываясь на предыдущем наблюдении, что TFAM не активирует репликацию мтДНК, считалось, что TFAM поддерживает мтДНК, повышая ее стабильность, служа защитным экраном [7, 9, 10, 31]. В настоящем исследовании мы обнаружили, что уровень белка TFAM был значительно снижен в клетках M-LPH-KO (рис. 9(а)). Это позволяет предположить, что повышенная степень повреждения мтДНК, наблюдаемая в клетках M-LPH-KO (рис. 4(а) и 5), была вызвана нестабильностью мтДНК, связанной со снижением TFAM.Что еще более интересно, не только TFAM, но и два фермента репарации ДНК, OGG1 и LIG3, восстанавливались на уровне белка с помощью M-LPH-KO. OGG1 отвечает за вырезание 8-оксогуанина, который обычно продуцируется АФК, тогда как LIG3 функционирует как ДНК-лигаза. Эти ферменты участвуют в митохондриальном BER, наиболее известном пути репарации мтДНК, и расположены как в митохондриях, так и в ядре. В совокупности эти данные свидетельствуют о том, что повышенная степень повреждения мтДНК в клетках M-LPH-KO, вероятно, связана с двумя факторами: нестабильностью мтДНК, вызванной снижением TFAM, и снижением способности репарации повреждений мтДНК в результате отсутствия двух основных факторов. ферменты БЭР.

В этом исследовании мы продемонстрировали, что митохондриальные TFAM и OGG1, оба из которых отвечают за целостность и поддержание целостности мтДНК, регулируются на уровне белка. Эти результаты согласуются с предыдущим наблюдением, что уровни мРНК и белка ферментов BER плохо коррелируют друг с другом [35]. Экспрессия белка TFAM регулируется несколькими способами, включая метилирование промотора гена TFAM, ингибирование экспрессии гена микроРНК [36] и селективную деградацию с помощью LONP1.LONP1 представляет собой АТФ-зависимую протеазу, участвующую в деградации неправильно свернутых, неправильно отсортированных и поврежденных митохондриальных белков, и известно, что она является компонентом митохондриальных нуклеоидов [31, 37]. Также хорошо известно, что уровни белков LONP1 и TFAM демонстрируют сильную обратную корреляцию [31]. Однако в этом исследовании мы подтвердили, что M-LPH-KO не влияет на уровень LONP1. Между тем, недавнее исследование предложило механизм регуляции TFAM, опосредованный фосфорилированием: фосфорилирование TFAM по серинам 55 и 56 протеинкиназой A блокирует его связывание с мтДНК, и полученный в результате TFAM без ДНК быстро и селективно расщепляется LONP1. Интересно, что наши экспериментальные результаты показали, что M-LPH оказывает прямое или косвенное влияние на состояния фосфорилирования TFAM и что состояния фосфорилирования будут связаны с их восприимчивостью к деградации. Другими словами, M-LPH может участвовать в поддержании мтДНК и, следовательно, митохондриальной функции, путем комплексной защиты белков, необходимых для стабильности и поддержания мтДНК, от деградации (рис. 11).


В настоящем исследовании с использованием клеток M-LPH-KO HepG2 мы наблюдали увеличение числа копий мтДНК, сопровождающееся увеличением повреждения мтДНК (рис. 8).Было показано, что среди белков, участвующих в целостности мтДНК, только TFAM и TWNK значимо коррелируют с количеством копий мтДНК. Гомозиготные KO TFAM или TWNK оба смертельны для мышей, а мыши с гетерозиготными KO любого из них обнаруживают снижение числа копий мтДНК [38, 39]. С другой стороны, у трансгенных мышей со сверхэкспрессией TFAM или TWNK наблюдается увеличение количества копий мтДНК в 1,5–2 раза [40, 41] и в 2–3 раза [41, 42] соответственно. Хотя эффекты на количество копий мтДНК, вызванные нарушением гена TFAM или TWNK, очень похожи друг на друга, механизмы, ответственные за регуляцию количества копий мтДНК, считаются совершенно разными: TFAM работает за счет увеличения упаковки и стабильности мтДНК, тогда как TWNK работает, усиливая свою репликацию [43].В настоящем исследовании M-LPH-KO приводил к увеличению TWNK одновременно с уменьшением TFAM на уровне белка (рис. 9 (а)). Следовательно, увеличение количества копий мтДНК, наблюдаемое в клетках M-LPH-KO HepG2, вероятно, вызвано увеличением TWNK и, как следствие, усилением репликации.

В нашем предыдущем исследовании с клетками нормальной почки человека HK-2 мы наблюдали, что миРНК-опосредованный нокдаун M-LPH вызывал увеличение образования АФК и потерю митохондрий в дополнение к повреждению мтДНК [20].Напротив, в настоящем исследовании с использованием клеток M-LPH-KO HepG2 не было обнаружено значительного влияния на уровни АФК и АТФ, несмотря на увеличение повреждения мтДНК (рис. 7). Мы предполагаем, что эти различия между клетками HK-2 и HepG2 были обусловлены наличием или отсутствием компенсаторного механизма увеличения числа копий мтДНК в ответ на повреждение мтДНК. Фактически, в нашем предыдущем исследовании было подтверждено, что нокдаун M-LPH, опосредованный siRNA, не влиял на содержание мтДНК в клетках HK-2 [20], нормальных эпителиальных клетках проксимальных канальцев почек человека (RPTEC) и клетках молочной железы человека. раковые клетки (MDA-MB-453) (R.Иида, М. Уэки и Т. Ясуда, неопубликованные данные). Кроме того, в качестве дополнительных доказательств можно также рассматривать следующее наблюдение: перед получением клеток M-LPH-KO HepG2 мы сначала пытались получить клетки M-LPH-KO HK-2, но все одноклеточные клоны не не размножались и постепенно погибали в течение двух месяцев. Следовательно, представляется вероятным, что настоящее успешное поколение клеток KO, вероятно, было связано с особыми характеристиками клеток HepG2. Различия в клеточных реакциях на повреждение мтДНК, подобные этому, могут быть одним из элементов, которые следует учитывать при разработке терапевтических подходов к заболеваниям, связанным с митохондриальной дисфункцией, вызванной повреждением мтДНК, включая рак, нейродегенеративные расстройства и сердечно-сосудистые заболевания.

Здесь мы сосредоточились на том, как M-LPH защищает мтДНК от окислительного повреждения в клетках HepG2. В дополнение к повреждению мтДНК представляется весьма вероятным, что M-LPH также играет роль в защите яДНК от повреждения, поскольку, во-первых, клетки M-LPH-KO HepG2 усиливали повреждение не только мтДНК, но и повреждения яДНК, а во-вторых, он ранее было показано, что M-LPH взаимодействует с h3AX [20], что тесно коррелирует с реакцией на повреждение яДНК. Молекулярная функция M-LPH в защите яДНК в настоящее время исследуется.

Доступность данных

В поддержку этого исследования не использовались никакие данные.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Благодарности

Эта работа была частично поддержана грантами на научные исследования от Японского общества содействия развитию науки (16K15400 и 26293162 Рейко Иида; 16H05272 Тосихиро Ясуда).

Врожденная непереносимость лактозы вызывается тяжелыми мутациями обоих аллелей гена лактазы | BMC Gastroenterology

Биосинтез, процессинг, клеточная локализация и функция мутантов LPH-Y1473X и LPH-D1796fs

До настоящего времени в финских семьях было идентифицировано семь мутаций в кодирующей области LPH. Недавнее генетическое тестирование выявило две новые мутации, Y1473X и D1796fs, которые были обнаружены в виде сложной гетерозиготной модели у японского младенца с CLD [3]. В этой статье взаимосвязь генотип/фенотип исследуется на биохимическом и клеточно-биологическом уровнях. Обе мутации расположены в домене IV внеклеточной области LPH, что совместимо с частичным укорочением гомологичного домена IV и полной элиминацией всего мембранного якоря, а также цитоплазматического хвоста.

Поскольку обе мутации появились в сложном гетерозиготном варианте у одного пациента, мы были заинтересованы в изучении влияния каждой отдельной мутации per se на ферментативную функцию и внутриклеточные транспортные события LPH.

Для этой цели мутации Y1473X и D1796fs были введены в кодирующую область LPH дикого типа отдельно (далее обозначаемые как LPH-Y1473X и LPH-D1796fs), а полученные мутанты были экспрессированы в клетках COS-1. Детергентные экстракты биосинтетически меченных трансфицированных клеток подвергали иммунопреципитации. Чтобы оценить различия в состоянии созревания и характере гликозилирования среди LPH дикого типа, LPH-Y1473X и LPH-D1796fs, иммунопреципитаты обрабатывали эндогликозидазой H [21].Endo H расщепляет исключительно богатые маннозой и некоторые гибридные типы N-гликанов, которые существуют в ER вплоть до цис -Гольджи. На рисунке 1A показано, что LPH дикого типа выявил богатую маннозой гликозилированную, эндо-H-чувствительную полосу массой 215 кДа и эндо-H-резистентную комплексную гликозилированную полосу массой 230 кДа. Напротив, LPH-Y1473X и LPH-D1796fs обнаруживали исключительно эндо-H-чувствительные полосы белка, богатого маннозой, соответственно меньшего размера, чем их необработанные формы. Кроме того, мы рассмотрели незаконный оборот двух мутантных белков, проведя эксперименты по преследованию импульсов.Для этой цели клетки COS-1 биосинтетически метили в течение 2 ч и преследовали в течение 0, 4, 8 и 12 ч. На рисунке 1B показано, что LPH дикого типа достигла состояния, при котором 50% белка является гликозилированным с высоким содержанием маннозы, а 50% — комплексным гликозилированием после 4 часов преследования. После 12 часов охоты можно было обнаружить только зрелую форму. Варианты мутантного белка, LPH-Y1473X и LPH-D1796fs, сохранялись как гликозилированные белки, богатые маннозой, но, что примечательно, полосы почти полностью исчезали через 8 часов чейза.Чтобы исследовать возможность того, секретируются ли в конечном итоге мутанты, собирали среду биосинтетически меченных клеток COS-1 и подвергали иммунопреципитации. Однако ни LPH дикого типа, ни два мутантных белка не проявляли каких-либо секретируемых форм (данные не показаны). Эти результаты ясно показывают, что мутанты сохраняются в своих богатых маннозой гликозилированных формах, вероятно, в ER, и в конечном итоге деградируют.

Рисунок 1

Кинетика биосинтеза и транспорта белков дикого типа и мутантных белков. клетки COS-1 временно трансфицировали кДНК, кодирующей LPH дикого типа, LPH-Y1473X или LPH-D1796fs, и использовали через 48 часов после трансфекции. A) Клетки метаболически метили [ 35 S] метионином в течение 6 ч непрерывно, лизировали, иммунопреципитировали mAb анти-LPH и обрабатывали эндо H. B) Клетки метили [ 35 S ] метионин в течение 2 ч и преследование в течение 0, 4, 8 и 12 ч с последующим лизисом клеток и иммунопреципитацией. Во всех этих экспериментах белки подвергали SDS-PAGE и авторадиографии.Количественную оценку проводили с помощью программного обеспечения Quantity One®.

Сохранение двух мутантов в виде богатых маннозой гликозилированных видов свидетельствует о локализации двух вариантов белка в ER. Чтобы обосновать эти результаты, используя другую процедуру, мы проанализировали внутриклеточную локализацию мутантов с помощью конфокальной иммунофлуоресцентной микроскопии. Как показано на рисунке 2, LPH дикого типа расположен в ER и аппарате Гольджи, а также на клеточной поверхности, в то время как оба мутантных варианта были преимущественно расположены в ER, что оценивалось по типичным сетчатым структурам ER.

Рисунок 2

Внутриклеточная локализация дикого типа и мутантов в клетках COS-1. Для визуализации LPH временно трансфицированные клетки COS-1, экспрессирующие LPH дикого типа, LPH-Y1473X или LPH-D1796fs, фиксировали 4% параформальдегидом и пермеабилизировали 0,5% сапонином. Иммуномаркировку проводили с использованием mAb анти-LPH (1:1000) в качестве первичного антитела и антимышиного IgG, конъюгированного с Alexa 488, в качестве вторичного антитела (1:500). Образцы анализировали с помощью конфокальной лазерной микроскопии.

Активный центр лактазы расположен на Glu1749, а флоризин-гидролазы на Glu1273 [12]. У мутанта LPH-Y1473X отсутствует сайт активности лактазы, поэтому ожидалось, что этот мутант не проявляет активности лактазы, что мы и подтвердили. Мутант LPH-D1796fs содержит активный центр лактазы, но его активность в отношении лактозы не обнаруживается (данные не представлены). Эти результаты показывают, что составная гетерозиготная структура этих двух функционально-неактивных мутантов ответственна за полную непереносимость лактозы у младенцев.

Потенциальные эффекты мутантов LPH-Y1473X и LPH-D1796fs на LPH дикого типа в гетерозиготном фоне

CLD у пациента первоначально предполагались по типичным симптомам мальабсорбции при потреблении молока, а затем по идентификации мутаций Y1473X и D1796fs на каждый аллель гена LPH.

Сложный гетерозиготный тип наследования в этом случае ХЗЛ поднимает вопросы, связанные с потенциальной толерантностью к лактозе у родителей, которые являются гетерозиготными носителями одного из дефектных аллелей LPH.Поэтому мы рассмотрели вопрос, достаточно ли одного нормального родительского аллеля в сочетании с больным для производства белка лактазы, обладающего адекватной способностью переваривать пищевую лактозу. Обоснованием этого предположения является димерная четвертичная структура LPH дикого типа, которая генерируется в ER и гарантирует ферментативную активность, а также транспортную способность LPH [16]. При условии выполнения минимальных требований к фолдингу, таких как правильный фолдинг доменов, участвующих в димеризации LPH, все же следует учитывать, что две разные изоформы белка, такие как LPH дикого типа и укороченный мутант LPH, могут образовывать гетеродимеры, которые могут регулировать ферментативная функция.Таким образом, мы воспроизвели ситуацию in vivo путем совместной экспрессии каждого мутанта отдельно с LPH дикого типа, оценили их потенциальное взаимодействие в экспериментах по совместной иммунопреципитации и проанализировали активность иммунопреципитированного LPH. На рисунке 3 показаны белковые полосы, соответствующие LPH дикого типа, которые были получены путем иммунопреципитации клеточных лизатов из котрансфицированных и биосинтетически меченных клеток. Поскольку ни мутанты LPH-Y1473X, ни LPH-D1796fs не появлялись на одной и той же дорожке электрофореза, мы делаем вывод, что эти мутантные формы не подвергались коиммунопреципитации и не взаимодействовали с LPH дикого типа.

Рисунок 3

Возможное взаимодействие LPH-Y1473X и LPH-D1796fs с LPH дикого типа в экспериментах по совместной трансфекции. клетки COS-1 временно трансфицировали либо кДНК, кодирующей LPH дикого типа, меченной myc (LPH-myc), либо клонами кДНК, кодирующими мутанты LPH-Y1473X и LPH-D1796fs. В другом наборе экспериментов коэкспрессию LPH-myc с LPH-Y1473X или с LPH-D1796fs проводили в клетках COS-1. Через 48 ч после трансфекции клетки метаболически метили [ 35 S] метионином в течение 6 ч непрерывно, лизировали, и лизаты подвергали иммунопреципитации либо антителом против myc для обнаружения LPH дикого типа, либо смесью антител mAb против LPH для обнаружения мутанты. Активность лактазы измеряли путем определения концентрации глюкозы, образующейся при гидролизе лактозы, методом монореагента глюкозооксидаза-пероксидаза с использованием фотометрического анализа. Общее количество белка в каждом образце определяли с помощью SDS-PAGE и авторадиографии для последующего расчета относительной удельной активности. Количественную оценку проводили с помощью программного обеспечения Quantity One®. Результаты LPH-Y1473X были взяты из другого геля более высокого качества.

Ферментативная активность LPH в экспериментах с котрансфекцией не изменила и не подтвердила мнение о том, что взаимодействие имело место.Это, в свою очередь, ясно указывало на то, что LPH дикого типа сохранял свою полную активность, поскольку он генерировал свои ферментативно активные гомодимеры.

Мутанты LPH-Y1473X или LPH-D1796fs не чувствительны к температуре

Некоторые мутации в белках, связанные с болезнями фолдинга белков, проявляют чувствительный к температуре паттерн, при котором понижение температуры приводит к восстановлению правильного фолдинга и дальнейшему переносу белков вне ЭР [5,23-25]. Чтобы определить, являются ли мутанты чувствительными к температуре и могут ли они выходить из ER в аппарат Гольджи с задержкой во времени, был проведен эксперимент с отслеживанием импульсов при 20 ° C.В контроле использовали аналогичный протокол, за исключением того, что температура была изменена на 37°C. LPH дикого типа можно было обнаружить как полосу богатого маннозой гликозилированного и сложного гликозилированного белка через 6 часов и 18 часов при температуре инкубации 20 ° C (рис. 4). При этой температуре белки преимущественно блокируются в аппарате Гольджи [26]. Это становится очевидным в 18-часовой временной точке погони, которая показывает значительное увеличение интенсивности сложного гликозилированного зрелого белка, который обрабатывается в аппарате Гольджи.В отличие от LPH дикого типа, оба мутантных белка появлялись в виде богатых маннозой гликозилированных видов после 6 ч чейзинга при 20°C и не достигали состояния дальнейшего созревания после 18 ч чейзинга, поскольку не появлялась сложная гликозилированная полоса.

Похожие записи

Вам будет интересно

Кем сейчас выгодно работать – Куда идти работать: топ-10 самых перспективных профессий в РФ

Что написать в хобби в резюме – пример 50 увлечений и интересов

Добавить комментарий

Комментарий добавить легко