Методика 5с: Система 5 с бережливое производство или стандарты рабочего места

Содержание

МЕТОДИКА ВНЕДРЕНИЯ 5S НА РАБОЧЕЕ МЕСТО

5S Рациональная организация рабочих мест

5S Рациональная организация рабочих мест Наводить порядок надо тогда, когда еще нет смуты. Лао Цзы ПРОИЗВОДСТВЕННЫЕ ПОТЕРИ В рамках бережливого производства выделяют 8 видов потерь. 1. Перепроизводство.

Подробнее

// 5С. От теории к практике

АВГУСТ 2013 РЕЗУЛЬТАТЫ РЕАЛИЗАЦИИ СИСТЕМЫ «5С» или как создать идеальное рабочее место Чтоб отлично шел процесс, ты обязан знать 5С // 5С. От теории к практике // Из истории В Японии в послевоенный период,

Подробнее

Локальный нормативный акт

МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РД ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ РЕСПУБЛИКИ ДАГЕСТАН «ТЕХНИЧЕСКИЙ КОЛЛЕДЖ» УТВЕРЖДЕНО приказом /5от «О?» Од’ 2019 И.

о. директора

Подробнее

Бережливое производство в ОАО «РЖД»

в ОАО «РЖД» Принципы Правила Инструменты» ЖД Р «ОАО и ч зада Клю чев ые Повышение деятельности Сокращение издержек Бережливое производство Задачи решаются, в том числе с помощью применения принципов БЕРЕЖЛИВОГО

Подробнее

ТЕОРИЯ ОГРАНИЧЕНИЙ: ПРОБЛЕМЫ ВНЕДРЕНИЯ

ТЕОРИЯ ОГРАНИЧЕНИЙ: ПРОБЛЕМЫ ВНЕДРЕНИЯ Чечет Д.М. Томский политехнический университет, г. Томск Научный руководитель: Плотникова И.В., к.т.н., доцент кафедры физических методов и приборов контроля качества

Подробнее

Список информационных источников

Список информационных источников 1.ГОСТ РВ 0015-002 2012 -Система разработки и постановки на производство военной техники. Система менеджмента качества. Общие требования»; 2.Репин В.В., Елиферов В.Г. Процессный

Подробнее

Система 5 S первый ключ к успеху

Система 5 S первый ключ к успеху Галина Косенко член Международной гильдии профессионалов качества, член ASQ, ведущий аудитор по ISO 9001:2000, ISO 22000 BSI, BV, Moody International, зарегистрированный

Подробнее

ОБУЧАЕМ ВНЕДРЯЕМ СОВЕРШЕНСТВУЕМ

КАЙДЗЭН 改善 ОБУЧАЕМ ВНЕДРЯЕМ СОВЕРШЕНСТВУЕМ «Улучшаем завод вместе!» ПЕРМСКИЙ ИНЖЕНЕРНО- ПРОМЫШЛЕННЫЙ ФОРУМ 19-20 апреля 2018 УЛУЧШЕНИЕ ПРОИЗВОДСТВЕННОГО ПРОЦЕССА ЗА ДВА МЕСЯЦА! РЕЗУЛЬТАТЫ РАБОТЫ Полный

Подробнее

5С НА ПРОИЗВОДСТВЕ И В ОФИСЕ. Москва 2016

5С НА ПРОИЗВОДСТВЕ И В ОФИСЕ Москва 2016 Цели и задачи Цель Сформировать навык применения инструмента 5С в своей рабочей среде Задачи Понять, что такое 5С Определить, что надо сделать, чтобы внедрить систему

Подробнее

Как внедрить бережливую технологию 5С

Редакция от 1 янв 2017 Как внедрить бережливую технологию 5С Ю.А. Романова Минздрав рекомендует главврачам внедрять бережливые технологии. Один из бережливых инструментов система «5С». Это не компьютерная

Подробнее

Репозиторий БНТУ УДК

УДК 658.562 158 НАПРАВЛЕНИЯ ОБЕСПЕЧЕНИЯ КАЧЕСТВА ОРГАНИЗАЦИИ ПРОЦЕССОВ ПРОИЗВОДСТВА НА ПРЕДПРИЯТИИ Каблашова И.В., д-р экон. наук, доцент Воронежский государственный технический университет Воронеж, Российская

Подробнее

Разумная производственная система

Разумная производственная система Подготовка рабочего места г. Москва 2012 год AVC Consulting Ltd., г. Москва, 2012 год. стр. 1 из 7 Система 6S состоит из 6 шагов-этапов. Шаг 1. Сортировка. Задачей шага

Подробнее

Цель обучения: 1. Цель реализации программы

Цель обучения: По окончании обучения слушатели освоят практические навыки по организации своей работы по принципам бережливого предприятия; будут способны разработать мероприятия по повышению эффективности

Подробнее

Правительство Российской Федерации

Правительство Российской Федерации Государственное образовательное бюджетное учреждение высшего профессионального образования «Государственный университет — Высшая школа экономики» Факультет Менеджмента

Подробнее

Отчет 1130/СК

ОС СМК АНО «ИнИС ВВТ» Отчет 1130/СК-2-2015 Главного эксперта по сертификационному аудиту системы менеджмента качества Федерального государственного автономного образовательного учреждения высшего образования

Подробнее

МЕЖОТРАСЛЕВЫЕ МЕРОПРИЯТИЯ

БОЛЬШАЯ ИНДУСТРИАЛЬНАЯ НЕДЕЛЯ МЕЖОТРАСЛЕВЫЕ МЕРОПРИЯТИЯ БЕРЕЖЛИВОЕ ПРОИЗВОДСТВО КАК ИНСТРУМЕНТ ПОВЫШЕНИЯ ЭФФЕКТИВНОСТИ ПРОИЗВОДСТВЕННЫХ СИСТЕМ Константин ЛЕОНИДОВ, Министерство промышленности и торговли

Подробнее

Работа состоит из следующего:

СОЮЗ МАШИНОСТРОИТЕЛЕЙ РОССИИ (ПО «ЭКСПЕРТ») НЕКОММЕРЧЕСКОЕ ПАРТНЕРСТВО «ЭКСПЕРТНЫЙ НАУЧНО-ТЕХНИЧЕСКИЙ СОЮЗ» Консультационные услуги по разработке, внедрению и подготовке к сертификации системы менеджмента

Подробнее

Методические рекомендации

Министерство образования и науки Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Владимирский государственный университет имени

Подробнее

Список информационных источников

спектрофотометра крови, а запаздывает на 10-30 минут. Проанализировав все вышеперечисленные неинвазивные методы измерения глюкозы в крови, приняв во внимание все недостатки уже известных приборов можно

Подробнее

ФОРУМ МОЛОДЫХ УЧЕНЫХ 3(19)

УДК 65.011.72 Новиков В.А., студент, 2 курс, Институт финансов, экономики и управления, Бачинский А.Г., студент, 3 курс, Институт финансов, экономики и управления, Перевезенцева Е.Д., магистрант, 1 курс,

Подробнее

Услуги по диагностике

Услуги по диагностике Диагностические услуги помогут Вам лучше спланировать свои действия, выявить возможные проблемы, а также проанализировать возможности для потенциальных улучшений. Кроме того, с нами

Подробнее

ПРОФЕССИОНАЛЬНЫЙ СТАНДАРТ

Проект ПРОФЕССИОНАЛЬНЫЙ СТАНДАРТ Дефектоскопист (наименование ) I. Общие сведения Ручной и автоматизированный контроль металла и сварных соединений оборудования и трубопроводов атомных электростанций (АЭС)

Подробнее

Преимущество ISO 9001.

Преимущество ISO 9001. Около 350 000 организаций во всем мире внедрили ИСО 9001. Преимущества, которые они получили: Повышение удовлетворенности потребителя; Улучшение производительности и эффективности

Подробнее

ISO 9001:2000 (ГОСТ Р ИСО )

ООО «-С.-Петербург» 190103, Санкт-Петербург, ул. Курляндская, д. 1, офис 629, тел./факс: (812) 340 0093 e-mail: [email protected] ISO 9001:2000 (ГОСТ Р ИСО 9001-2001) ДЛЯ ПРОВЕДЕНИЯ АУДИТА СИСТЕМ

Подробнее

Высшая школа экономики, Пермь, 2015

Высшая школа экономики, Пермь, 2015 www.hse.ru 1. KPI измеритель производительности персонала KPI направления управления персоналом KPI подразделений KPI верхнего уровня Высшая школа экономики, Пермь,

Подробнее

Основы «бережливого производства»

Основы «бережливого производства» Докладчик: Начальник бюро контроля качества ОТК Бельская Наталья Сергеевна г. Йошкар-Ола 2015 Декабрь 2011 Для чего работает любая организация? г. Йошкар-Ола 2015 Какой

Подробнее

«Акустический контроль и диагностика»

Министерство образования и науки Российской Федерации федеральное государственное автономное образовательное учреждение высшего образования «НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ ТОМСКИЙ ПОЛИТЕХНИЧЕСКИЙ УНИВЕРСИТЕТ»

Подробнее

ЧИЩЕ БЕЗОПАСНЕЕ РАЗУМНЕЕ

ЧИЩЕ БЕЗОПАСНЕЕ РАЗУМНЕЕ Эксперт в сфере очистки и дефектации промышленных компонентов с самыми жесткими требованиями FinnSonic известен своим клиентам как специалист по поставке разумных, безопасных и

Подробнее

Бережливое производство: 5С — АНСУ

ОРГАНИЗАЦИЯ ЭФФЕКТИВНЫХ РАБОЧИХ МЕСТ ПО СИСТЕМЕ 5С.

ВИЗУАЛИЗАЦИЯ.

Своё название методика получила по названию 5 последовательных шагов, каждый из которых в своем названии имеет первую букву «С» и является системным подходом к организации, наведению порядка и уборке на рабочих местах. Система 5С является базой для формирования культуры Бережливого производства (культуры непрерывных улучшений Кайдзен) и повышения производственной дисциплины.

Семинар-практикум «Система 5С (5S)» — организация безопасных, эргономичных и эффективных рабочих мест на производстве и в офисе на площадке заказчика, направлен на освоение методик, приобретение практических навыков проведения улучшений рабочих мест, оценки соответствия рабочих мест критериям безопасности, эргономичности и эффективности. 

Для достижения целей по критериям безопасности, эргономичности и эффективности рабочих мест используется визуализация.

Визуализация – это метод представления информации в виде, удобном для зрительного наблюдения и анализа (например, в виде рисунков и фотографий, графиков, диаграмм, структурных схем, таблиц, карт и т. д.).

Инфографика

 Продолжительность тренинга: 2-5 дней.

Количество участников: 10 — 25 чел.

Категория участников:

  • Рабочие и служащие
  • Руководители функциональных подразделений
  • Топ-менеджмент

Требуемый уровень подготовки участников:

  • подготовка не требуется

Формат обучения:

  • открытый
  • корпоративный

Вид обучения:

Раздаточный материал:

  • печатные материалы.

Сертификат:

  • Компании «ANSU«

Целевая аудитория тренинга

  • Руководители, начальники и заместители начальников цехов, начальники участков, мастера, бригадиры)
  • Специалисты, ИТР
  • Операторы, рабочие
  • Специалисты инженерной службы
  • Специалисты отделов по управлению персоналом
  • Специалисты подразделений по повышению операционной эффективности

Цели обучения

  • Получить практические знания и навыки по развёртыванию системы 5С на всём предприятии/организации
  • Получить знания и навыки по организации безопасных, эргономичных и эффективных рабочих мест на пилотном участке
  • Получить практические знания и навыки по оценке соответствия рабочих мест критериям безопасности, эргономичности и эффективности.
  • Вовлечь сотрудников предприятия в процесс непрерывных улучшений.
  • Научить находить и ликвидировать потери, связанные с проблемами в организации рабочих мест.

Описание тренинга-практикума

Обучение 5С проводится в форме 25% времени – тория, 75% времени практическая работа на площадке заказчика. При проведении тренинга реализован принцип обучения – обучение действием. Проводится интенсивно и направлен на решение конкретной задачи улучшения рабочего места.

В ходе 5 дневного тренинга участники последовательно реализуют 5 шагов методики, своими руками совершенствуют пилотный участок:

0S — подготовка к организации рабочих мест по системе 5С

1S – сортировка предметов, находящихся на рабочих местах

2S – создание порядка на рабочих местах

3S – содержание рабочих мест в чистоте и порядке

4S – стандартизация

5S – самодисциплина и самосовершенствование.

 

В ходе 2 дневного тренинга участники последовательно реализую 5 шагов методики, своими руками совершенствуют пилотный участок:

0S — подготовка к организации рабочих мест

1S – сортировка предметов, находящихся на рабочих местах

2S – создание порядка на рабочих местах

3S – содержание рабочих мест в чистоте и порядке.

Формат обучения

  • лекция
  • практическая работа в гемба
  • групповые обсуждения

Раздаточный материал

  • Раздаточный материал по тренингу 5С предоставляется в печатном виде (pdf).

Сертификат

По окончании курса всем участникам обучения выдается фирменный сертификат компании «ANSU».

Бережливое складирование, или как методика 5С поможет улучшить ваш склад. | SKLAD-KLAD

Поговорим о бережливом складировании. С развитием отрасли все больше и больше данная тенденция становится актуальной. Однако, сама идея пришла от концепции бережливого производства. Поэтому сначала разберемся в родоначальнике данного движения.

Что же такое бережливое производство?

концепция управления производственным предприятием, которая основана на постоянном стремлении предприятия к устранению всех видов потерь. Бережливое производство предполагает вовлечение в процесс оптимизации каждого сотрудника и максимальную ориентацию на потребителя. Возникла как интерпретация идей производственной системы компании Toyota при исследовании её феномена, когда автопроизводитель ранее выпускавший низкокачественные автомобили превзошел американские одновременно по качеству и цене (это очень сильно пошатнуло конкурентоспособность американского автопрома), суть интерпретации наложилась на уже существующие понятие «шесть сигм» и получилось «lean+6 sigma».

Вот основной принцип бережливого производства:

Источник: http://olimpsov.ru/texnologii-berezhlivogo-proizvodstva/

Источник: http://olimpsov.ru/texnologii-berezhlivogo-proizvodstva/

Хотя эта концепция изначально создавалась для реализации только в производстве, она может быть применена и в других отраслях, включая складирование, благодаря своей простой структуре.

Что такое бережливое складирование?

В контексте складирования идея состоит в том, чтобы исключить те процессы и действия, которые поглощают ресурсы, но не создают никакой дополнительной ценности. Это достигается путем применения системы бережливого производства 5С, которая включает сортировку, соблюдение порядка, содержание в чистоте, стандартизацию и совершенствование, к процессам склада.

Почему бережливое складирование необходимо?

Потребность в методологии бережливого производства на складах лучше всего можно понять в контексте проблем, с которыми менеджеры склада сталкиваются каждый день . Вот несколько основных:

· Снижение эксплуатационных расходов

· Сокращение сроков выполнения заказа

· Увеличение количества заказов

· Увеличение количества заказов со срочной доставкой

· Увеличение стоимости рабочей силы

· Управление несколькими каналами доставки

· Управление растущим количеством SKU

· Нехватка места

· Сезонный / непостоянный спрос

И это лишь некоторые проблемы, которые возникают перед лицом растущих перспектив торговли. Бережливое производство приведет к повышению эффективности, уменьшению количества ошибок и максимальной оптимизации активов, а именно к:

  • Стандартизации рабочего процесса
  • Оптимизации использования активов за счет поиска подходящего места для нужного инвентаря или оборудования
  • Устранению неэффективности погрузочно-разгрузочных работ
  • Сокращению временных потерь
  • Стандартизации процессов, упрощающих управление и оценку нескольких артикулов
  • Лучшему управлению человеческими ресурсами
  • Обеспечению постоянного улучшения и обновления.

В пресс-релизе McKinsey & Company говорится, что в зависимости от характера бизнеса:

Применение бережливого управления складированием может сэкономить до 20% -50% затрат.

Теперь пройдемся по уже упомянутым 5 принципах бережливого производства и посмотрим детальнее на их применение в логистике, а именно в складировании.

1. Сортировка

Первый и главный принцип бережливого складирования, которые предусматривает следующие действия:

  • Удаление ненужных вещей, таких как поврежденные / устаревшие товары, излишки, сломанные поддоны, неисправное оборудование и т. д. Позволит с легкостью решить проблему нехватки места.
  • Сокращение или полное устранение ненужных перемещений, например, создание поперечного прохода в зоне сбора для сокращение времени пути операторов.
  • Замена ручного сбора бумаги такими технологиями, как сканеры, голосовой сбор и т. д.
  • Выделение объектов, которые необходимо утилизировать, и их хранение в отдельном месте до получения разрешения на окончательную утилизацию.

2. Соблюдение порядка

После сортировки следует соблюдение порядка. Решите, как организовать вещи таким образом, чтобы повысить эффективность.

Вам помогут следующие действия:

  • Размещение наиболее часто используемых товаров/вещей в более легкодоступных местах.
  • Добавление бирок и ярлыков инвентаря на склад и использование корзин, для экономии времени при поиске товаров.
  • Размещение складских инструкций и схем для сокращения ошибок и увеличения эффективности работы складских сотрудников.
  • Хранение пустых поддонов и упаковки в легкодоступном месте для моментального использования по необходимости.
  • Установка предупреждающих и напоминающих знаков. К примеру, с целью информирования о необходимости заряжать используемое оборудования по окончании рабочего дня.

3. Содержание в чистоте

Не менее важный принцип, который подразумевает уборку рабочего места после окончания рабочего дня.

Итак, как придерживаться данного правила:

  • Убирайте все рабочие зоны в конце смены. Это позволяет моментально обнаружить какие-либо дефекты, ошибки или повреждения и сразу же сообщить о них.
  • Поместите мусорные баки перед каждым проходом, чтобы не засорять склад использованной упаковочной бумагой или сломанными паллетами.
  • Кроме того, держите наготове инвентарь для уборки, чтобы моментально среагировать на форс-мажорную ситуацию и не замедлять работу склада.

4. Стандартизация

Порядок можно обеспечить только путем стандартизации. Создание стандартов для всех рабочих зон на складе имеет достаточно важное значение.

Как стандартизировать:

  • Обсудите каждый этап работы с персоналом и задокументируйте стандартизированные действия для выполнения той или иной задачи.
  • Сделайте стандартизированные действия видимыми для сотрудников. Они всегда должны быть на виду.
  • Визуализируйте каждое стандартизированное действие. Объясняйте его максимально ёмко и просто.
  • Используйте плакаты и баннеры для информирования сотрудников.
  • Внедрите учебные пособия и видеоролики, которые позволят ускорить учебный процесс и облегчить восприятие информации.

5. Совершенствование

Необходимо постоянно совершенствовать операции склада и его работу. Стандартизация без постоянного совершенствования неэффективна.

Необходимы следующие действия:

  • Поощряйте персонал за применение новых стандартов и предложение инновационных идей. Не зацикливайтесь на старом. Будьте новаторами.
  • Придерживайтесь «кайдзен» — принципу, который гласит, что изменения — это хорошо, и они всегда влекут за собой развитие и улучшение.
  • Проводите регулярные аудиты и проверки, чтобы убедиться в соблюдении стандартов.
  • Принимайте во внимание творческие и новаторские идеи сотрудников.
  • Будьте открыты для создания новых стандартов, если существующие стандарты уже не работают.

По мере того, как индустрия развивается, цифровизация складов все больше «захватывает» индустрию, бережливое складирование останется экономным, но не уступающим в эффективности методом повышения эффекктивности работы склада и увеличения своей конкурентоспособности. Следуйте простым правилам, и результат не заставит ждать!

Больше интересностей на https://sklad-klad.ru/

Как воспитать успешных подростков по методу 5С

Обычно о воспитании думают родители – как и что говорить, чему учить, на что обращать внимание. Однако работая с детьми и подростками, мы так или иначе влияем на их становление как личностей. Хочется надеяться, что такую же точку зрения поддерживают, если не все, то многие наши коллеги. 

Недавно мне под руку попалась книга Эстер Войджицки “The Woj Way. Как воспитать успешного человека” (How to raise successful people: The Woj Way). Книга написана для родителей, и в основном рассказывает о том, как воспитывалась сама Эстер, и как она воспитывала своих дочерей. 

Для справки: Эстер Войджицки – американский журналист, основатель программы медиаискусства в средней школе Пало-Альто в Пало-Альто, Калифорния; мать троих дочерей: Сьюзен (генеральный директор YouTube), Джанет (антрополог и исследователь, получившая звание доцента кафедры педиатрии) и Энн (соучредитель 23andMe – биотехнологическая компания, помогающая людям узнать об их предрасположенности к заболеваниям на основании анализа предоставленного биоматериала). 

Внушительные достижения для всей семьи. Конечно, можно говорить о том, что проживая в кампусе Стэнфордского университета, сложно вырасти и не добиться таких высот, каких добились дочери Эстер. Так или иначе, в книге есть некоторые правила, которых придерживалась Эстер, и которые могут быть полезны не только родителям, но и учителям, помогая воспитывать учеников успешными и готовыми к жизни.

В оригинале метод воспитания звучит как TRICK – TRUST, RESPECT, INDEPENDENCE, COLLABORATION, AND KINDNESS, в русской же версии книги метод называется 5С – САМОДОВЕРИЕ, САМОУВАЖЕНИЕ, САМОСТОЯТЕЛЬНОСТЬ, СОТРУДНИЧЕСТВО, СЕРДЕЧНОСТЬ. 

Сначала в книге даются вопросы для анализа своего жизненного опыта с точки зрения каждого из аспектов. В своей работе также полезно проанализировать свой опыт будучи учеником и учителем. Далее Эстер рассказывает о своем видении каждого аспекта и реализации их в своей воспитательной деятельности не только с детьми, но и своими студентами. Рассмотрим, как учителям может быть полезен такой подход.

САМОДОВЕРИЕ (TRUST) 

Здесь речь идет о доверии к себе – это самое важное, что нам нужно для успешности реализации всех остальных “правил”. Доверяйте своей интуиции. Для учителя это может значить, что не всегда стоит придерживаться плана урока или распланированного тайминга, когда появляется потребность в дополнительной практике или подходящей теме для обсуждения, воспользуйтесь этой возможностью – результат будет гораздо эффективнее, ведь мы учим людей, а не учебники. 

Также доверять необходимо и детям/подросткам: например, не ставить двойку за невыполненное задание, а дать возможность сдать его в следующий раз – именно так ученик увидит, что к нему относятся не как к роботу, а как к человеку со всеми его чувствами и потребностями. Также можно доверять выбор тематического урока, подготовку к мероприятию своими силами, составление заданий для теста и так далее.

САМОУВАЖЕНИЕ (RESPECT)

Уважение к ученику как личности – принятие его таким, какой он есть, со всеми его личностными особенностями. Также важно и учить подростков принятию друг друга, в этом помогает парная и групповая работа – при этом для усложнения задачи можно в пары и группы помещать учеников с разным уровнем и взглядами на жизнь: это поможет воспитать терпимость к разным людям и принимать чужие мнения как имеющие право на существование.

Уважение к человеку – это еще и вера в него, а значит требование более высоких результатов. Как показывает практика, если ребенок или ученик чувствует, что его ценят и уважают, то он и сам ставит себе более высокую планку. И начинает уважать себя за свои успехи. Из личного опыта: есть у меня ученица подросток, с которой работаем уже более двух лет. В начале нашей совместной работы у нее не было желания заниматься, мы встречались раз в неделю на полтора часа. Девочка пропускала уроки и не видела смысла заниматься. Сейчас, спустя 2 года, мы занимаемся 3 раза в неделю по часу, она никогда не пропускает уроки, даже если испытывает усталость после школы или головную боль. А недавно она стала инициатором того, чтобы один урок в неделю был полностью разговорным. Это стремление к знаниям вызывает во мне гордость. Обсуждая ее успехи и перемену в отношении, она сама говорит, что раньше она не хотела заниматься, потому что ее постоянно критиковали, в школе учителя не верили в ее успех, а предыдущий учитель не интересовался ею как личностью.

САМОСТОЯТЕЛЬНОСТЬ (INDEPENDENCE)

Взрослые склонны к гиперопеке из благих побуждений – помочь своим детям или ученикам. В некотором смысле сверхзабота о ребенке – медвежья услуга: в ребенке развивается неуверенность в своих силах, постоянный поиск поддержки и одобрения, неспособность выразить свое мнение. Однако гораздо более полезными навыками, которые мы можем ученикам привить, будут ответственность и самоконтроль.

Развивайте кругозор учеников, обсуждая с ними различные темы по интересам. В группе распределяйте в пары учеников с разными интересами и точками зрения для обмена опытом и поиском нового. Давайте ученикам самим подготавливать проекты, выступать инициаторами новых тем и заданий, поощряйте собственные способы обучения – дайте ученикам свободу в выборе методов запоминания слов, просите обсуждать друг с другом как они выполняют задания, поощряйте peer correction. 

СОТРУДНИЧЕСТВО (COLLABORATION)

Ученика необходимо воспринимать как партнера по учебе. Приучайте своих учеников к тому, что вы все в классе – одна команда. Не сравнивайте их друг с другом, а показывайте что они могут друг другу дать. Совместная работа может обогатить не только результат работы, но и личностные качества в целом. Сегодня умение работать в команде считается одним из ключевых навыков 21-го века. Уроки английского языка могут помогать развить это качество до высокого уровня – здесь встречаются разные темпераменты учеников, разные интересы, культуры и так далее. Работая в группах и парах на уроке, ученики, как уже говорилось выше, могут научиться взаимному уважению, принятию, доверию. 

СЕРДЕЧНОСТЬ (KINDNESS)

Доброта – ключ ко многим дверям. Именно добрым отношением к ученикам лучше всего завоевывать их сердца. Нужно понимать, что доброта не является противопоставлением дисциплине, никто не говорит о вседозволенности, но доброе и где-то эмпатичное отношение к своим ученикам поможет вызвать ответ на доброту и заботу, а также в союзе с уважением создать в классе атмосферу особенной доверительности и комфорта.

Все начинается с малого: правила поведения, уважения, не суждения, которые можно обговорить на первом занятии, создав “Классный договор”, вернувшись к этой теме при столкновении с трудностями в отношениях в классе. Учите своих студентов быть благодарными друг другу, помогать и прощать. Обсуждайте мировые проблемы и учите эмпатии.

Пять «Почему?» — Метод решения проблемы через поиск первопричины

Метод Пяти «Почему?» едва ли не самый простой среди многообразия идей, рожденных Toyota. Но при этом невероятно сильный. И к тому же весьма известный.

В настоящее время техника определения первопричины какой-либо проблемы пятикратным вопросом «Почему» используется в концепциях бережливого производства, кайдзен, 6 сигма и других. Более того, область применения этого потрясающе эффективного инструмента давно расширилась за пределы производства — в свойственной детям манере в процессе анализа проблем докапываются до их истинных причин в различных областях человеческой деятельности. И это не удивительно. Во-первых, метод легок и универсален, тысячу раз описан в литературе и интернете; во-вторых, как и любая другая идея из разряда «здравого смысла» — в голову приходит вне зависимости от знаний истории производственного менеджмента. И он потрясающе экономит время — для анализа достаточно и 10 минут.

Тайити Оно, описывая созданную им систему, говорит об этом методе как о научной основе Производственной системы Тойоты. При этом он отсылает нас к Сакити Тойода, которого называет автором правила. Предполагается, что идея метода была сформулирована им в 30-ых годах ХХ века.

Справедливости ради, нужно отметить, что вопрос «Почему?» при поиске первопричин и их возникновения начали использовать философы IV-III веков до н. э., а автором причинно-следственной концепции, применяемой для любого доказательства в логике, считают Сократа. Но в вопросах повышения производительности труда и сокращения издержек этот метод впервые стали применять в семье Тойода.

Пять «Почему?» (five whys)

Основа научного подхода компании Toyota заключается в том, чтобы при обнаружении проблемы пять раз задать вопрос «Почему?» (why), что обозначается как 5W. Если пять раз получить ответы на вопрос «Почему?», то причина проблемы и метод ее решения станут очевидны. Решение (или «Как?» — how-to) обозначается как 1H. Таким образом, пять «Почему?» равны одному «Как?» (5W = 1H).

Первопричина (real cause)

Под «причиной» проблемы скрывается ее первопричина (глубинная причина). В каждом случае мы должны докопаться до настоящей причины, пять раз задавая вопрос: «Почему?». В противном случае нельзя принять контрмеры и по-настоящему решить проблему.

Таким образом, Пять «Почему?» — это эффективный инструмент как индивидуального, так и коллективного изучения причинно-следственных связей, лежащих в основе той или иной проблемы, определения причинных факторов и выявления глубинных, коренных причин. Метод используется, когда истинная причина проблемы не ясна и для ее решения недостаточно ресурсов для детального исследования и статистического анализа.

При этом важно не найти виноватого, как принято в традиционном менеджменте, когда у каждой проблемы есть лицо и имя, а выявить именно системную причину. «Нет обвинений, нет наказаний» — как мы знаем — одно из ключевых отличий системы мышления Тойоты от традиционной управленческой парадигмы. Решение даже всех промежуточных проблем, без внимания к первопричине, рано или поздно приведет к повторным сбоям. А наказание «виновных» не только навсегда закроет возможность их участия в поиске истинных факторов, но и спровоцирует их стремление скрывать любые несоответствия.

Почему именно Пять «Почему?». Число 5 выбрано, скорее всего, эмпирически, но есть, наверно, и доля некой сакральности, так сложилось, что пятерка обозначает завершенность. Пяти вопросов, как правило, достаточно для выявления источника проблемы. Но, несмотря на название, для поиска причин каждого конкретного несоответствия может потребоваться как меньшее, так и большее количество вопросов.

Так как при ответе на поставленный вопрос возможно возникновение нескольких вариантов, метод «5 почему» не исключает выстраивания «дерева» причин. Поэтому подход схож с методом причинно-следственных диаграмм и диаграмм Исикавы («Рыбья кость»). Вполне допустимо, что некоторые причины  в процессе анализа окажутся общими для сразу нескольких веток.

Завершать анализ Пять «Почему?» следует одним ответом на вопрос «Как» по каждой из обнаруженных коренных причин полученного дерева или диаграммы. Ну и, конечно, полученные ответы должны вылиться в реализацию решений.

Для того, чтобы вы имели более полное представление о методе 5 «почему?», я хотел бы использовать выдержки из первоисточника, и процитировать архитектора производственной системы компании Toyota Тайити Оно:

Пятикратное «Почему?»

Пятикратное «Почему?»

 

Приходилось ли вам, столкнувшись с какой-либо проблемой, остановиться и пять раз подряд задать себе вопрос: «Почему это случилось?» Сомневаюсь. Давайте попробуем сделать это вместе. Представьте, например, что у вас перестал работать автомобиль:

1. Почему автомобиль остановился?

Потому что была перегрузка, и полетел предохранитель.

2. Почему была перегрузка?

Потому что подшипник был плохо смазан.

3. Почему подшипник был плохо смазан?

Потому что насос, подающий смазку, плохо работал.

4. Почему он плохо работал?

Потому что поршень износился и разболтался.

5. Почему поршень износился?

Потому что не поставили фильтр, и в поршень попала металлическая стружка.

Пятикратное повторение вопроса «Почему?» поможет вам разобраться в первопричине проблемы и решить ее. Если вы не пройдете через весь цикл вопросов, то, возможно, решите, что достаточно просто заменить предохранитель или поршень насоса. Тогда буквально через несколько месяцев та же проблема с автомобилем возникнет снова.

Собственно говоря, производственная система Тойоты строится на использовании и развитии именно этого научного подхода. Пять раз задав один и тот же вопрос «Почему?» и каждый раз ответив на него, мы можем добраться до сути проблемы, которая часто прячется за более очевидными, лежащими на поверхности причинами.

«Почему в компании Toyota Motor Company один работник может управлять лишь одним станком, а на ткацкой фабрике Toyoda одна молодая девушка контролирует сразу 40 или 50 автоматизированных ткацких станков?»

Начав с этого вопроса, мы получили следующий ответ: «Станки в компании Toyota не рассчитаны на то, чтобы автономно останавливаться, когда заканчивается единичный цикл обработки». Отсюда родилась идея автономизации станков — их автоматизации с элементами человеческого интеллекта.

На следующий вопрос: «Почему мы не можем сделать так, чтобы детали подавались точно вовремя?» — был получен такой ответ: «Потому что скорость, с которой изготавливаются детали, не позволяет нам знать, сколько их производится в минуту». Отсюда возникла идея выравнивания производства.

Первым ответом на вопрос: «Почему мы производим слишком много деталей?» — было: «Потому что мы не можем сбавить темпы или полностью предотвратить перепроизводство». Так появилась идея о визуальном управлении, которая, в свою очередь, привела к идее канбана.

В предыдущей главе отмечалось, что производственная система Тойоты основывается на полном исключении потерь. Почему вообще появляются потери? Задавая подобный вопрос, мы на самом деле подходим к вопросу о прибыли, которая является основным условием нормального функционирования бизнеса. Одновременно мы задаемся вопросом о том, почему люди работают.

При функционировании производственного предприятия данные играют очень большую роль, но я считаю, что реальные факты важнее. Если в случае возникновения какой-либо проблемы мы недостаточно упорно ищем первопричину, предпринятые меры могут оказаться тщетными. Вот почему мы постоянно повторяем вопрос «Почему?». В этом заключается научная основа системы Тойоты.

При функционировании производственного предприятия данные играют очень большую роль, но я считаю, что реальные факты важнее. Если в случае возникновения какой-либо проблемы мы недостаточно упорно ищем первопричину, предпринятые меры могут оказаться тщетными. Вот почему мы постоянно повторяем вопрос «Почему?». В этом заключается научная основа системы Тойоты.

Сталкиваясь с любой проблемой, я всегда пять раз задаю вопрос «Почему?». Это правило также усвоено от Тойода Сакити, который имел привычку наблюдать. Можно сколько угодно рассуждать об улучшении работы, но конкретные предложения возникнут только после досконального изучения производства. Проведите в производственном отделе целый день и понаблюдайте за происходящим. В итоге вы поймете, что надо сделать.

Интересно, что описание метода Пяти «Почему?» встречается и в книге Элизабет Хаас Эдерсхейм Лучшие идеи Питера Друкера:

Вне зависимости от того, что стоит на повестке дня – проблема, возможность или то и другое вместе, — Toyota тратит время и силы на выполнение домашнего задания, необходимого для того, чтобы увидеть картину в целом и выйти за рамки очевидного, что позволит при принятии решения отличить основные причины и сигналы от симптомов. Поэтому Toyota акцентирует внимание на том, что всегда необходимо пойти и увидеть все собственными глазами, а затем 5 раз задать себе вопрос «почему».

Возможность увидеть все собственными глазами помогает менеджерам понять, как проявляются проблемы и/или возможности. Однако домашнее задание не будет считать выполненным до тех пор, пока, как я уже говорила раньше, менеджеры Toyota 5 раз не зададут себе вопрос «почему», чтобы понять основные причины проблемы или основные способы реализации возможности. Как объяснял Тайити Оно, создатель производственной системы Toyota: «Сказать правду, производственная система Toyota построена на практике и развитии этого научного подхода. Если мы 5 раз спросим себя «почему»и каждый раз будем давать ответ на этот вопрос, то сможем понять реальную причину проблемы, которая нередко скрыта за более заметными симптомами».

На полу заводского цеха лужа масла. Почему? Масло вытекает из машины. Почему? Повреждена прокладка. Почему? Потому что мы купили прокладки из дешевого материала. Почему? Потому что нам назначили за них лучшую цену. Почему? Потому что работа агентов по закупкам вознаграждается и оценивается исходя из краткосрочной экономии, а не долгосрочных результатов. Итак, в чем же действительно заключается проблема и, соответственно, каким условиям должно соответствовать решение? В луже масла на полу, которую можно с легкостью вытереть менее чем за две минуты и никто из руководства этого не заметит? Или это система вознаграждения агентов по закупкам, которая приводит к покупке несовершенного оборудования и, следовательно, должна быть изменена? То, что масло будет вытерто с пола, решит поверхностные вопросы, но не предотвратит повторного возникновения проблемы, в то время как новые правила закупок это сделают.

Очень надеюсь, что в своей практике вы пользуетесь этим простой техникой, а если нет — что данный материал сподвигнет вас на ее применение в своей работе и не только.


Павел Рабунец
Руководитель и главный редактор Leaninfo.ru. Отвечает за развитие издательского направления — Leanbooks.ru. Преподает «бережливое производство» в Томском политехническом университете.

Поделиться с друзьями:

Подписывайтесь на Leaninfo.ru в соцсетях: Facebook или ВКонтакте.
Или следите за новостями бережливого производства по email.

Смотрите также:


Методика внедрения инструмента бережливого производства 5S

Библиографическое описание:

Васильева, С. Е. Методика внедрения инструмента бережливого производства 5S / С. Е. Васильева, С. Ю. Данилова. — Текст : непосредственный // Молодой ученый. — 2016. — № 13 (117). — С. 388-393. — URL: https://moluch.ru/archive/117/31280/ (дата обращения: 28.10.2021).



Ключевой целью системы 5S является создание организованного и чистого рабочего места, которое предусматривает безопасное и стабильное кружение, более лёгкое определение потерь и отклонений [1].

Предлагаемая методика 5S основана на пятиуровневой последовательности (таблица 1).

Таблица 1

Описание системы 5S

Уровень

Название

Описание

1

Сортировка

Хранение исключительно необходимого

2

Создание порядка

Свое место для каждой вещи и каждая вещь на своем месте

3

Соблюдение чистоты

Приведение зоны к первоначальному виду и поддержание аккуратного рабочего места

4

Стандартизация

Стандарты, кто что и когда делает во всех зонах

5

Совершенствование

Поддержание системы и измерение ее эффективности

Рассмотрим каждый уровень более подробно.

Уровень 1. 1S. Сортировка

Сортировка — это хранение только того, что необходимо для создания ценности для клиента, когда ничего больше нельзя убрать. Необходимые на рабочем месте предметы отделены от ненужных предметов, которые затем удаляются. Это относится не только к дополнительным материалам (например, инструменты, оборудование, стеллажи), но и к прямым материалам. Для прямых материалов требуется установить максимальные и минимальные уровни всех запасов. Минимальный уровень устанавливается на основе Клиентского спроса при сохранении стабильного производства. Максимальный уровень запасов — это минимальное количество, необходимое для поддержания стабильного производства и, соответственно, поддержания нетерпимости к потерям. Сортировка тесно связана с Принципами управления материалами на предприятии. Она требует хорошего баланса рабочей нагрузки смежных процессов, которые стандартизированы таким образом, что производство является стабильным. Сортировка — один из самых важных инструментов предприятия для достижения уровня 3 ключевых концепций предприятия.

Уровень 2. 2S. Создание порядка

На этом уровне определяется место для каждого необходимого предмета и расположение этих предметов в зоне, так что в основном у всего есть своё место, и всё находится на своих местах. Кроме того, в качестве ключевого элемента этого уровня, важно выявление источников загрязнения и устранение основных причин этого для обеспечения требуемых условий и избежания нежелательных элементов или нежелательных ситуаций.

Уровень 3. 3S. Соблюдение чистоты

На этом уровне наступает необходимость генеральной уборки, приведения зоны в первоначальное состояние, а также поддержание аккуратного рабочего места. Она начинается с полной очистки и приведения всех элементов в зоне к начальным условиям, а затем устанавливается график уборки для поддержания стандартов и выявления отклонений от нормы. Подметание полов, вытирание машин, покраска обеспечивают приведение всего на заводе в чистый вид. Чистка позволяет увидеть повреждения, такие как трещины, протечки и износ; и предвидеть будущие поломки. Очистка скребком должна проводиться на регулярной основе. Выделите определенное время для уборки (например, последние пять минут смены). Определите, что надо чистить, а затем распределите задачи между конкретными людьми. Необходимый уборочный инвентарь и расходные материалы должны быть доступны в точке использования.

Уровень 4. 4S. Стандартизация

Стандартизация — это включение практик первых трёх S в ежедневную работу, это определение стандарта, кто, что, когда и как делает на всех участках. Стандарты 5S для всех зон завода устанавливаются и поддерживаются с помощью визуальных изображений стандартного состояния. Для поддержания хорошего состояния 5S каждый должен знать, что он несёт ответственность за выполнение, а также что, почему, когда, где и как делать.

Ниже на рисунке 1 представлены ключевые факторы успеха от внедрения системы 5S. На рисунке 2 представим более подробно последовательность операций процесса на примере предприятия по производству автокомпонентов.

Рис. 1. Развернутое описание ключевых факторов успеха

Рис. 2. Последовательность операций процесса

Уровень 5. 5S. Совершенствование

На этой фазе целью является поддержание системы 5S и создание системы оценки для обеспечения эффективности. Обеспечьте дисциплинированное соблюдение правил и процедур 5S для предотвращения нарушений. Придерживайтесь правил для поддержания стандарта и продолжайте совершенствоваться каждый день.

В результате предложенное мероприятие позволит:

– 5S тесно связана с безопасностью труда

– Рабочая среда влияет на вовлеченность сотрудников

– На чистом и организованном предприятии легче определить потери

– 5S влияет на восприятие нас клиентами и инвесторами

– 5S и наглядное управление предусматривают безопасную и стабильную среду, более легкое определение потерь и ненормальных состояний [2].

После внедрения процедуры 5S необходимо разработать оценочный лист (таблица 2) и один раз в месяц оценивать уровень применения данной процедуры.

Таблица 2

Оценочный лист по 5S апримере предприятия по производству автокомпонентов

5S

AREA

Участок

1

Очень плохо — Нет контроля

AUDITED BY

5S

2

Плохо — Некоторый контроль

Date

12.02.2014

3

Ср уровень — Частично под контролем

Пошив

4

Хорошо — Приемлемо

5

Очень хорошо- Под контролем

5S

No

Чек лист

Описание

1

2

3

4

5

Comments

Seiri

Separate

Селекция

1

Все машины и части оборудования постоянно используются

Нужно нам или нет? Ненужные отметить красной лэйблом 5S.

5

2

Нет посторонних предметов на рабочих площадях

Нужно нам или нет? Проверить. Ненужные отметить красной лэйблом 5S.

5

3

Все ненужные части четко обозначены

Все ненужные предметы (помеченные красной лэйблом 5S) убраны

5

4

Все контейнеры, рабочие области, стеллажи и инструменты четко обозначены

Проверить

5

25

5

Доски отчетов обновлены и хорошо представлены

Все графики и отчеты действительны и презентабельны

5

Seiton

Straighten

Сортировка

6

Все площади четко обозначены?

Все участки и материалы четко обозначены?

5

7

Все документы и файлы промаркированы и аккуратно размещены

Документы и файлы промаркированы и правильно размещены

5

8

Места хранения на рабочих местах и рабочие места разработаны с целью простоты использования

Все расположено в пределах вытянутой руки

5

9

Весь запас храниться в спец месте

Места для всего и все на своих четко обозначенных местах

4

Не укрыты часть стеллажей банка кроя

24

10

Зоны досок контроля чистые и проход к ним не затруднен

Нет загромождений в проходах к доскам контроля

5

Seiso

Scrub

Уборка

11

Проверяемая площадь всегда чистая и свободная от лишних предметов

Стараться удалить грязь повторно не повредит

5

12

Машины чистые?

Все машины очищены от грязи пыли и масла

5

13

Действует система по уборке (часть ODS) — отображена и актуальна

Операторы поддерживают чистоту в течение смены

5

14

Нет кабелей, проводки, воздухоотводов, лежащих на полу или плохо закрепленных

Всё закрепляется четко на месте

5

25

15

Уборочное оборудование

Хранение оборудования рядом с рабочей зоной

5

Seiketsu

Standardise

Стандартизация

16

Показаны основные процедуры и стандартные операции отображены

Четко видны и актуальны

5

17

Операторы прошли тренинг и знают 5S

Операторы знают 5S

5

18

Показать стандарты 5S

Стандарты 5S показаны

5

19

Аудиты 5S регулярны и результаты представлены

Проверить отчет по аудитам

5

25

20

Вывоз отходов

Есть мусорные ведра и они регулярно опустошаются

5

Shitsuke

Sytemise

Систематизация

21

Спецодежда

Все операторы носят спецодежду и защитные приспособления

5

22

Ознакомление с 5S и ОТиТБ

Все операторы ознакомлены с 5S и требованиями ОТиТБ

5

23

Мастерские 5S в случае необходимости

Проверять отчеты 5S после каждого изменения layout или запуска новой модели/проекта

5

24

Все ознакомлены с планом эвакуации, техникой безопасности и сборки

Спросить оператор о местоположении

5

25

25

Информация по качеству представлена для мотивации персонала (IPPM и т. д.)

Данные показаны и операторы ознакомлены?

5

Необходимые условия для успешной реализации процедуры:

Определенное лидерство по предприятию, выполнение обходов 5S

– Ресурсы, определенные по участкам

– Выбор показательной области для создания концепции, которая может использоваться для

– распространения на остальную часть предприятия

– Выполнение перекрёстных проверок и закрытие вопросов

– Выполнение графика уборки

– Видение будущего состояния и чёткий план действий по его достижению

Таким образом, предложенная методика позволит эффективно организовать рабочее место.

Литература:

  1. Агеева И. М., Данилова С. Ю. Оптимизация производственного процесса за счет внедрения инструментов бережливого производства 5S / И. М. Агеева, С.Ю, Данилова // «Современные подходы к трансформации концепций государственного регулирования и управления в социально-экономических системах»Материалы 2-й Международной научно-практической конференции Курск, 19 февраля 2013 г. в 2-х томах: Изд-во ЗАО «Университетская книга, 2013. — Ч.1. — С. — 25–31.
  2. Степина, С. Е., Чернова Д. В. Методика анализа логистических процессов автосервисного предприятия в рамках концепции бережливого производства / С. Е. Степина, Д. В. Чернова // Вестник Самарского государственного экономического университета. — 2011. С.100–106.
  3. Womack, J. Seeing the Whole: Mapping the Extended Value Stream [Text] / J. Womack, D. Jones. — Brookline: Lean Enterprise Institute, 2002. — 152 р.

Основные термины (генерируются автоматически): место, уровень, AREA, AUDITED, IPPM, ODS, аккуратное рабочее место, оценочный лист, рабочее место, стабильное производство.

Тренинг 5С — LEAN-FABRIKA

Метод 5С является одной из основ ЛИН философии и поподает под метод пунктового Кайдзена.Это метод организации рабочего места, ведущий к устранению разтрат, повышению продуктивности и безопасности на рабочем месте. 5С это основа для введения остальных изменений и ЛИН тренинга.

Название методики 5С выходит из пяти японскиз слов:
  • Seiri = сортировать – отсортировка ненужных вещей
  • Seiso = чистить – уборка рабочего места
  • Seiton = систематизировать – распределение, маркеровка
  • Seiketsu = стандартизировать – определение правил, стандартизация
  • Shitsuke = все время улучьшать – соблюдать все пункты и все время их улучшать

 

 

В эитих пяти шагах рабочее место избавится от потерь и организуется так, чтобы оптимальой выработке ценностей ничего не мешало.Самым частым плюсом внедрения 5С является заметное уменьшение рабочего пространства для выполнения опрнделенной задачи,улучшение организации рабочего места со стороны размещения материалов и инструментов,устранение ненужных движений на рабочем месте и повышение ергономики процеса.

 

Цель и содержание тренинга 5С:

  • Ознакомление с методом 5С – основой ЛИН философии
  • Предложение по реализации проекта 5С
  • Практический опыт по реализации упражнения 5С. Уборка рабочего места.
  • Симуляция введения 5С а производстве
  • Формы для 5С

 

Использованые инструменты и методы обучения 5С:

  • Выявление разтрат

 

Целевая аудитлрия тренинга:

Топ Менеджер II
Руководитель ||||||
Мастер ||||||||||
Оператор / Рабочий ||||||||||

 

Нужны знания перед началом обучания — никаких

длина – 1 день

Фотографии с тренинга:

 
 

 

 

Массово-параллельное решение для картирования взаимодействий между элементами генома

Abstract

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть идентифицированы с помощью методологии захвата конформации хромосомы (3C). 3C преобразует физические взаимодействия хроматина в конкретные продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микроматрицы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения.Мы применили 5C для анализа области 400 т.п.н., содержащей человеческий β-глобиновый локус и консервативную пустынную область гена размером 100 т.п.н. Мы подтвердили 5C путем обнаружения нескольких ранее идентифицированных петлевых взаимодействий в локусе β-глобина. Мы также идентифицировали новое петлевое взаимодействие в клетках K562 между контролирующей областью β-глобинового локуса и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетического переключения генов глобина. 5C должен быть широко применим для крупномасштабного картирования цис — и транс — сетей взаимодействия геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются активные усилия по картированию генов и регуляторных элементов по всему геному человека (ENCODE Project Consortium 2004). Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ только 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http: //genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно нанести на карту все гены и функциональные элементы, а также определить все отношения между ними. Например, необходимо идентифицировать все регуляторные элементы каждого гена. Это усилие осложняется тем фактом, что геномные позиции генов и элементов не предоставляют прямой информации о функциональных отношениях между ними. Хорошо известный пример — энхансеры, которые могут регулировать несколько генов-мишеней, расположенных на больших расстояниях генома или даже на разных хромосомах, не затрагивая гены, расположенные непосредственно рядом с ними (Spilianakis et al.2005; Вест и Фрейзер 2005).

Недавние данные показывают, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямых физических взаимодействиях со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения показывают, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Таким образом, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами можно обнаружить с помощью метода захвата конформации хромосомы (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует сшивание формальдегидом для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Затем взаимодействующие элементы перевариваются рестрикционными ферментами и внутримолекулярно лигируются (). Частота лигирования двух рестрикционных фрагментов является мерой частоты, с которой они взаимодействуют в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотеку 3C генерируют с помощью обычного 3C, а затем преобразуют в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в мультиплексной установке. Затем библиотеки 5C анализируют на микрочипе или путем количественного секвенирования. ( B ) Дизайн праймера 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-конец, содержащий последовательность промотора Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину рестрикционного сайта. Все обратные праймеры содержат общий 3′-конец с комплементарной последовательностью Т3 (T3c) и фосфорилируются на 5′-конце. Прямой и обратный праймеры 5C отжигаются с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации дрожжевой хромосомы III (Dekker et al. 2002) и с тех пор применялся для анализа нескольких локусов млекопитающих, таких как β-глобиновый локус (Tolhuis et al.2002; Palstra et al. 2003; Vakoc et al. 2005), локус цитокинов Т-хелперов типа 2 (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом петля ДНК выходит наружу. 3C также использовался для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально связанными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005; Ling et al. 2006; Xu et al. 2006 г.). Вместе эти исследования предполагают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для обнаружения индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микроматрицы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует высоко мультиплексную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или путем количественного секвенирования ДНК.

5C был разработан и утвержден путем анализа человеческого β-глобинового локуса и консервативной области пустыни гена, расположенной на хромосоме человека 16. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий петель ДНК. Интересно, что анализ 5C также идентифицировал петлевое взаимодействие между β-globin Locus Control Region (LCR) и γ-δ межгенным регионом. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в клетках плода на экспрессию β-глобина во взрослых клетках (Calzolari et al.1999; Грибнау и др. 2000).

5C должен быть широко применим для определения связности цис и транс регуляторных элементов во всех крупных геномных областях. Кроме того, эксперименты 5C могут быть спроектированы таким образом, чтобы можно было создать полные карты взаимодействия для любой большой интересующей области генома, которые могут выявить местоположения новых регуляторных элементов генов, а также могут предоставить подробные сведения о сворачивании хромосом более высокого порядка.

Результаты

Метод 3C был подробно описан (Dekker et al.2002; Splinter et al. 2004; Vakoc et al. 2005; Dekker 2006; Miele et al. 2006) и проиллюстрирован в. Эксперимент 3C генерирует сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие по всему геному. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C частоты индивидуальных взаимодействий определяют путем количественной оценки образования предсказанных продуктов лигирования «голова к голове» с помощью полуколичественной ПЦР ().В качестве контроля ПЦР используется библиотека, содержащая все продукты лигирования в эквимолярных количествах. Контрольную библиотеку получают путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.

Краткое описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al. 1988; Li et al. 2005; Peck et al. 2006). Можно лигировать только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы на основе LMA являются количественными и могут выполняться на высоких уровнях мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al.2004; Бибикова и др. 2005; Hardenbol et al. 2005; Wang et al. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают на библиотеке 3C и лигируют. Используют два типа праймеров 5C: прямые 5C и обратные праймеры 5C. Эти праймеры сконструированы таким образом, что прямой и обратный праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (). Праймеры 5C, которые отжигаются рядом друг с другом, затем лигируют Taq-лигазой.На этом этапе создается библиотека 5C, которая амплифицируется с универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируют только тогда, когда оба отжигаются с конкретным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C образуются и как часто. В результате библиотека 5C представляет собой количественную «точную копию» части библиотеки 3C, как определено с помощью коллекции праймеров 5C.

Прямой и обратный праймеры 5C разработаны так, чтобы содержать уникальную последовательность, соответствующую смысловой и антисмысловой цепи 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. В дополнительном материале).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Для анализа взаимодействий между множеством рестрикционных фрагментов несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, только один праймер на каждый фрагмент, прямой или обратный, можно использовать в данном эксперименте 5С. Для облегчения лигирования все обратные праймеры фосфорилируются на своих 5′-концах.Эта конструкция праймера 5C позволяет одновременную амплификацию всех потенциальных взаимодействий между всеми фрагментами рестрикции, распознаваемыми прямым праймером, и всеми фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в человеческом β-глобиновом локусе

Мы разработали и оптимизировали подход 5C, проанализировав человеческий β-глобиновый локус. Этот локус был выбран потому, что несколько петлевых взаимодействий были ранее обнаружены 3C, а также вторым методом, RNA-TRAP (Carter et al.2002; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с использованием 5C можно использовать для проверки нового метода.

Человеческий β-глобиновый локус состоит из пяти онтогенетически регулируемых β-глобиноподобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, HBB . ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную перед кластером генов (). LCR характеризуется пятью сайтами гиперчувствительности к DNaseI (HS1-5) и необходим для тканеспецифической и независимой от положения экспрессии нижележащих β-глобиновых генов (Li et al.2002; Стаматояннопулос 2005). Предыдущий 3C анализ мышиного β-глобинового локуса выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). LCR, как было обнаружено, взаимодействует с элементами HS, расположенными выше (HS-62.5 / HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ человеческого β-глобинового локуса и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положение ГС обозначено черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»: «entrez-нуклеотид», «attrs»: {«text»: «BU661736», «term_id»: «23373918», «term_text»: «BU661736»} } BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью β-глобинового локуса.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось y указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение по крайней мере трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (S.E.M.). ( C ) Типичное титрование библиотеки 3C в одноплексном LMA с праймерами 5C. Возрастающие объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров гена пустыни 5C, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют собой S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено на 1. Каждое значение гистограммы представляет собой среднее значение по крайней мере трех ПЦР; полосы представляют собой S.E.M.

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя стандартный метод 3C. Локус анализировали в линии клеток эритролейкемии К562 и в линии лимфобластоидных клеток, трансформированных EBV, GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (Дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов ВАС (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и рестрикционными фрагментами EcoRI по всему β-глобиновому локусу определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействий, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, консервативной пустынной области гена на хромосоме 16 (область ENCODE ENr313) (Консорциум проектов ENCODE 2004 г.).

Нормализованные результаты представлены в. В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие из внутренней непосредственной близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлевых взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006 г.). Важно отметить, что случайные коллизии, по прогнозам, будут постепенно уменьшаться для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 высокие частоты взаимодействия наблюдались, в частности, между LCR и рестрикционным фрагментом, расположенным на ∼40 kb ниже и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения в субядерной локализации.

На основании этого анализа мы пришли к выводу, что конформация человеческого β-глобинового локуса сравнима с мышиным локусом с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в экспрессирующих глобин клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямого и обратного праймеров 5C, чтобы убедиться, что этот метод может количественно детектировать продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5C, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA выполняли с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (созданной из клеток K562), и образование лигированных прямого и обратного праймеров количественно оценивали с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается при наличии неспецифической ДНК, зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

Обнаружение LMA петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одноплексный LMA для количественного определения взаимодействий петель хроматина в β-глобиновом локусе. Мы сосредоточились на взаимодействиях с участием LCR и трех диагностических фрагментов в β-глобиновом локусе (обозначенных полосами): рестрикционного фрагмента, расположенного сразу после LCR, рестрикционного фрагмента, который перекрывает ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между генами δ- и β-глобина.Мы разработали обратный праймер 5C для рестрикционного фрагмента, перекрывающий HS5 LCR, и прямой 5C праймер для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с отдельными парами праймеров 5C в присутствии возрастающих количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнительная).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем расчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы обнаружили, что данные, полученные с помощью LMA, близко воспроизводят данные 3C, включая петлевое взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изученные здесь частоты взаимодействия (три в β-глобиновом локусе и одна в контрольной области) быть обнаружены и количественно определены в мультиплексной LMA-реакции.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы вычислили нормализованные частоты взаимодействия, как описано выше. Мы снова получили те же результаты, что и с обычным 3C (, правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием высоко мультиплексированного LMA

Для всестороннего 5C-анализа взаимодействий хроматина в крупных геномных областях потребуются высокие уровни мультиплексирования в сочетании с высокопроизводительным методом анализа 5C-библиотек.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и исследовали два высокопроизводительных метода обнаружения для анализа библиотек 5C: микроматрицы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех рестрикционных фрагментов EcoRI, которые перекрывают LCR, и прямые праймеры 5C для 55 рестрикционных фрагментов в области 400 т.п.н. вокруг LCR. Этот дизайн праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. Ниже).Мы также сконструировали 10 прямых праймеров 5C и 10 обратных праймеров 5C по всей области размером 100 т.п.н. в контрольной области генной пустыни. Прямой и обратный праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема конструирования праймеров позволяет обнаруживать матрицу взаимодействий по всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве шаблонов. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри β-глобинового локуса, 100 взаимодействий по всей генной пустыне и 590 взаимодействий между двумя геномными областями. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в. Мы использовали специфические праймеры для ПЦР для количественной оценки количества конкретных продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше.Мы обнаружили, что данные 5C близко воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнительная) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C повторяет профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина HS5 локуса β-глобина человека в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микроматрицы. Ось y указывает нормированные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а полосы ошибок представляют собой S.E.M. Схематическое изображение всего локуса представлено на вершине . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Планки погрешностей указывают стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчетов. Стандартные отклонения были распространены с использованием дельта-метода. ( D ) Корреляция между профилями 3C и 5C человеческих β-глобиновых локусов из клеток K562. Результаты 5C микроматрицы и секвенирования ДНК сравнивали с соответствующими данными 3C путем вычисления кратной разницы (логарифмическое соотношение 5C / 3C) для каждой пары взаимодействующих фрагментов (х-ось). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и путем количественного секвенирования

Мы проверили, можно ли использовать обнаружение микроматриц и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микроматрицы, мы амплифицировали библиотеки 5C, описанные выше, с универсальными праймерами, меченными Cy3.Помеченные библиотеки 5C затем гибридизовали с специально разработанным микрочипом, который может обнаруживать конкретные продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, которые разделяют один полусайт. Для оценки кросс-гибридизации на полусайтах микроматрица также содержала зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микроматрицы, которая допускает наименьшую перекрестную гибридизацию, на каждый зонд наносили пятно с 18 полусайтами различной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C были гибридизованы с массивом, и была определена специфическая гибридизация и гибридизация половинного сайта. Мы обнаружили, что зонды, которые состоят из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень перекрестной гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, и частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с помощью библиотеки 5C, на сигнал, полученный с помощью контрольной библиотеки (см. Ниже; дополнительную таблицу 7).

Крупномасштабный 5C-анализ человеческого β-глобинового локуса. ( A ) Положения прямого (, верхний, ) и обратный (, нижний, ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью 5C и микрочипов ( верхний ), 3C ( средний ) и 5C и анализа количественного секвенирования ( нижний ).Β-глобиновый локус, проиллюстрированный выше профилей, включает в себя особенности, описанные в. Направленная вперед стрелка указывает местоположение альтернативного сайта начала транскрипции ε-глобина. Светло-оранжевые и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелки указывают HS, идентифицированные в клетках K562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагалось, являются ортологами HS-62.5 / -62.0 в локусе мышей (Farrell et al.2002; Bulger et al. 2003). ( C ) Профиль взаимодействия хроматина HS2 / 3/4 LCR с областью 400 т.п.н. вокруг LCR, как определено с помощью микроматрицы ( вверху ) и количественного секвенирования ( внизу ). Цветные вертикальные полосы подчеркивают взаимодействия между LCR и вышележащими HSs и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C путем количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК, каждая из которых имеет длину ~ 100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул.Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микроматрицы, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки с помощью платформы GS20, разработанной 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160000 считываний последовательностей (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали количество раз, когда каждый конкретный продукт лигирования 5C был секвенирован (см. Методы; дополнительная таблица 5).Поскольку каждый продукт лигирования был секвенирован много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз секвенирования продукта 5C в библиотеке 5C на количество раз, которое он секвенировал в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ β-глобинового локуса

Сначала мы проанализировали профили взаимодействия HS5 по всему β-глобиновому локусу размером 100 т.п.н., обнаруженные на микрочипе () и с помощью количественного секвенирования ().Для сравнения, тот же профиль взаимодействия был также определен стандартным 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микроматрицы, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C β-глобинового локуса в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлевое взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-глобина, который слабо экспрессируется в клетках K562, но молчит в GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы сравнили наборы данных 5C и 3C напрямую, вычислив для каждой пары взаимодействующих фрагментов кратную разницу между их частотами взаимодействия, определенную с помощью 5C и 3C.Мы обнаружили, что разница в данных 5C, полученных с помощью обнаружения микроматрицы и обычного 3C, обычно меньше двух раз (). Однако большие различия наблюдались при сравнении данных 5C, полученных путем количественного секвенирования, с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном путем секвенирования, по сравнению с полуколичественным ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на диаграмму рассеяния (Дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием, и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации гена пустынной контрольной области. ( A ) Положения чередующихся 5C прямого ( верхний ) и обратный ( нижний ) праймеров по всей контрольной области генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( левая панель ), 5C и микрочипов ( средняя панель ), а также 5C и количественного секвенирования ( правая панель ). Частоты взаимодействия представлены в зависимости от геномного расстояния между взаимодействующими фрагментами. Полоски представляют собой S.E.M. Частоты взаимодействия, обнаруженные в ячейках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание: праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с этими праймерами, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

Взятые вместе, эти результаты обеспечивают четкое доказательство принципа того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой производительности. .

Взаимодействия между HS5 и вышележащими элементами

LCR мыши взаимодействует с HS элементами (HS-62.5 / HS-60), расположенными на расстоянии до 40 kb выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли функционально эквивалентные взаимодействующие элементы в этой области генома человека. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.н. выше LCR, ортологичны генам, расположенным на 40 т.п.н. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области связаны.Кроме того, мышиный элемент HS-62.5 / HS-60 встроен в последовательность, аналогичную последовательности, расположенной на 90 т.п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная на ~ 90 т.п.н. выше LCR человека, является ортологичной области, расположенной на ~ 40 т.п.н. выше локуса мыши, предполагая, что эта область может также взаимодействовать с LCR в человеческих клетках. Чтобы объективно оценить, взаимодействует ли LCR с какими-либо вышестоящими элементами в локусе человека, описанный выше эксперимент 5C был разработан, чтобы включить анализ большой области, расположенной перед LCR.

Мы проанализировали профили взаимодействия, полученные с помощью обнаружения на микрочипах и количественного секвенирования HS5 с областью до 280 т.п.н. перед LCR. Оба набора данных показали, что взаимодействия во всей этой области обычно намного ниже, чем наблюдаемые между LCR и β-глобиновым локусом. Однако в обеих клеточных линиях мы действительно обнаружили повышенные частоты взаимодействия во всем большом домене, расположенном на 50–100 kb выше LCR (). Этот результат был подтвержден традиционным анализом 3C (см.верхняя, средняя и нижняя панели). Эта область содержит три гена обонятельных рецепторов и множество сайтов HS (Bulger et al. 2003).

Эти результаты предполагают, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в локусе мыши. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местоположения новых предполагаемых регуляторных элементов.

Параллельный анализ множественных профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между множественными интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, прямой и обратный праймеры 5C были разработаны для одновременного обнаружения профилей взаимодействия каждой из трех субсекций LCR с 400 т.п.н. окружающего хроматина.Данные, полученные с помощью микроматричного анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2 / 3/4 фрагмента LCR, очень похож на профиль HS5 (). Интересно, что мы обнаружили, что в клетках K562 HS2 / 3/4 чаще взаимодействует с сайтами по всему β-глобиновому локусу, чем HS5, подтверждая, что эти HSs могут вносить наибольший вклад в формирование петель хроматина с LCR. Анализ 5C 3′-конца LCR, который содержит HS1, не дал достаточных уровней продуктов лигирования для получения значительного числа считываний последовательности.Анализ сигналов гибридизации микроматрицы подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали паттернам, полученным для HS5 и HS2 / 3/4 (дополнительная таблица 7 ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ β-глобинового локуса был сфокусирован на картировании взаимодействий между фиксированным регуляторным элементом, LCR и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов определены плохо. Здесь мы приводим пример альтернативной схемы конструирования праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Описанный выше 5C-анализ включал 10 прямых и 10 обратных 5C-праймеров для рестрикционных фрагментов, расположенных в контрольной области генной пустыни (). Важно отметить, что прямой и обратный праймеры были разработаны для чередования рестрикционных фрагментов ().В совокупности эти праймеры выявляли взаимодействия хроматина во всем регионе. Частоты взаимодействия, определенные с помощью анализа микрочипов и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействия снижается с увеличением геномного расстояния (). Аналогичные результаты были получены с помощью обычного анализа 3C.

Графики не показывают, где вдоль хромосомы были измерены определенные частоты взаимодействия.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямым и обратным праймерами 5C в виде двумерных тепловых карт, на которых цвет каждого квадрата является показателем частоты взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этой генной пустынной области, очень отличается от наблюдаемого в β-глобиновом локусе и согласуется с поведением хаотической спирали хроматинового волокна без дальнодействующих петлевых взаимодействий (Rippe 2001; Dekker et al.2002; Деккер 2006).

Обсуждение

Разработка 3C значительно облегчила обнаружение и изучение взаимодействий цис и транс между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить диапазон приложений 3C, позволяя комплексное и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа β-глобинового локуса

Мы проверили 5C путем обнаружения взаимодействий петель хроматина в человеческом β-глобиновом локусе. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессируемыми генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в GM06990, LCR также взаимодействует с 3′-HS1 элементом и большим доменом, расположенным на 50–100 kb выше. Последняя область соответствует области вокруг HS-62.5 / HS-60 в локусе мышей (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HSs была предложена для создания хроматинового концентратора или специализированного ядерного компартмента, предназначенного для транскрипции β-глобиновых генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые HS в β-глобиновом локусе связывают инсулятор-связывающий белок CTCF (Farrell et al., 2002; Bulger et al., 2003) (а для HS5 человека см. Дополнительный рис.6), и было предложено, что этот белок опосредует их взаимодействия и образование хаба хроматина (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых из элементов не влияет напрямую на экспрессию β-глобина (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они не могут напрямую регулировать экспрессию β-глобина, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2 / 3/4 очень похожи, за исключением того, что HS2 / 3/4 чаще взаимодействует с β-глобиновым локусом, особенно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al. 1993; Peterson et al. 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген глобина наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое взаимодействие петель хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что этот регион участвует в контроле развития β-глобинового локуса (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнительная информация), что позволяет предположить, что петлевое взаимодействие может участвовать в активации транскрипции. Эта область также содержит промотор для большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-глобина (Gribnau et al. 2000).Некоторые пациенты, которые страдают от наследственной персистенции гемоглобина плода, несут делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al. 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными областями γ – δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенной области, несмотря на присутствие несколько слабых предполагаемых сайтов связывания CTCF (дополнительный рис. 6).

Обнаружение микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования микроматриц, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также заметили несколько отличий. Во-первых, динамический диапазон обнаружения микроматрицы был меньше, чем у количественного секвенирования, как наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученными с помощью микроматричного анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ – δ (рис.). Эти различия могут отражать внутренние предубеждения в методах обнаружения, но также могут быть связаны с экспериментальными вариациями между независимо созданными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает больший динамический диапазон и устраняет необходимость в создании определенного массива для каждой интересующей области генома. С другой стороны, микроматричный анализ в настоящее время более рентабелен, особенно когда конкретная область генома должна быть проанализирована в большом количестве различных условий.

Данные 5C, полученные путем секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно определили 451 взаимодействие между β-глобиновым локусом и пустынной областью контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-глобина и область генной пустыни должны преимущественно взаимодействовать. Поэтому мы предположили, что эти частоты межхромосомного взаимодействия будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие частоты фонового взаимодействия между двумя регионами (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2 / 3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймеров или экспериментальный шум. Будущие крупномасштабные анализы 5C предоставят более подробное представление об этих проблемах.

Приложения 5C

5C полагается на мультиплексную амплификацию, опосредованную лигированием, и, таким образом, потенциально ограничивается количеством праймеров 5C, которые могут использоваться в одной реакции.В других анализах, основанных на LMA, в одной реакции успешно использовались многие тысячи праймеров. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси ∼6000 праймеров (Бибикова и др., 2005). Другим примером является использование высоко мультиплексированных LMA с до 20 000 зондов молекулярной инверсии в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10000 праймеров 5C в одном эксперименте, до 25 миллионов различных взаимодействий хроматина могут быть обнаружены параллельно с участием до 40 МБ (10000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для высоко мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые были использованы для создания проанализированных здесь библиотек 5C, прекрасно распознали многочисленные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы ожидаем два типа приложений 5C, которые различаются схемами разработки праймеров 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными интересующими элементами генома, подобно анализу локуса β-глобина, описанному здесь.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис или в транс , чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов, параллельно в одной реакции, с последующим анализом на специально разработанной микроматрице или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого интересующего фиксированного фрагмента, а прямые праймеры 5C конструируют для всех других рестрикционных фрагментов, как показано на.Этот тип анализа позволит быстро обнаруживать сети взаимодействий между множеством генов и регуляторных элементов в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействий, которые охватывают большую часть или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямой и обратный праймеры 5C разработаны для чередования рестрикционных фрагментов, как это выполнено здесь для контрольной области генной пустыни (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой 5C-анализ не предоставит полную карту взаимодействий для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются прямыми праймерами или обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с перестановкой схемы конструирования праймеров 5C для получения частично перекрывающихся матриц взаимодействий. В сочетании эти карты могут дать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будут соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействий может использоваться в качестве инструмента открытия для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействий может также предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Селекция ВАС и подготовка контрольной библиотеки

Контрольная библиотека для человеческого β-глобинового локуса и пустынных областей гена (области ENCODE ENm009 и ENr313, соответственно) была создана, как описано (Dekker 2006; Miele et al.2006 г.). Вкратце, набор бактериальных искусственных хромосом (ВАС), покрывающих обе области генома, смешивали, переваривали с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы ВАС из локуса β-глобина и областей пустыни гена были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Следующие семь клонов ВАС использовали для области β-глобина: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов ВАС был выбран для покрытия пустынной области гена 0,5 Mb и включал RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Исследовательского института Детской больницы Окленда (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из EBV-трансформированных B-лимфоцитов и была получена из Coriell Cell Repositories (CCR). Эту клеточную линию культивировали в среде 1640 Roswell Park Memorial Institute (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37 ° C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C выполняли с лог-фазой клеток GM06990 и K562 с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Общую РНК из клеток в логарифмической фазе выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго (dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно оценивали с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические человеческие праймеры β-глобина, использованные в этом анализе, суммированы в дополнительной таблице 1.

Дизайн праймера 5C

Прямой и обратный праймеры были сконструированы для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI.Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления составляла 72 ° C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были сконструированы так, чтобы включать 5′-конец хвоста, который включает (5’– 3 ‘) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированная последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были сконструированы так, чтобы включать 3’-конец хвоста, который включает (5’– 3 ‘) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5C каждый содержали половину сайта рестрикции EcoRI, и только обратные праймеры фосфорилировались на 5’-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотека 3C (представляющая около 150 000 копий генома) или контрольная библиотека (5 нг) была смешана с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ DTT). Образцы денатурировали 5 мин при 95 ° C и отжигали 16 ч при 48 ° C. Отожженные праймеры лигировали в течение 1 ч при 48 ° C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при pH 7,6, 31,25 мМ ацетат калия, 12,5 мМ ацетат магния, 1,25 мМ NAD, 12,5 мМ DTT, 0,125% Triton X -100), содержащий 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65 ° C в течение 10 мин. Продукты лигирования 5C амплифицировали с помощью ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в реакциях ПЦР объемом 25 мкл (32 цикла по 30 секунд денатурирования при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C. ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления не включенных праймеров и других загрязняющих веществ в соответствии с рекомендациями производителя.

Одноплексный и шестиплексный анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~ 150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировались на 35 Циклы ПЦР: 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали с помощью бромистого этидия (0,5 мкг / мл). Sixplex 5C анализ выполняли путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C образцов из шести комплексов детектировали с помощью ПЦР со специфическими внутренними праймерами ПЦР и измеряли на агарозных гелях, как описано выше. ПЦР-детекция продуктов 5C с линейным диапазоном была подтверждена путем двукратного серийного титрования мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микроматрицы библиотеки 5C

Библиотеки 5C были получены путем выполнения множественной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченным праймером обратной ПЦР, комплементарным общей последовательности 3′-конца обратных праймеров 5C (Cy3 -T3modif). Синтез и гибридизация без масок проводились с использованием 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al. 1999; Nuwaysir et al. 2002; Kim et al. 2005; Selzer et al.2005). Каждый массив содержал смысловую цепь предсказанных продуктов лигирования 5C. Матрицы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов с увеличивающейся длиной признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зондов массива (Дополнение). Полное описание конструкции массива доступно по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp.) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Библиотека 5C Анализ высокопроизводительного секвенирования ДНК

Библиотеки 5C были созданы с 73 праймерами 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с 5′-концевыми фосфорилированными праймерами для ПЦР и обрабатывали для пиросеквенирования одной молекулы, как описано ранее (Margulies et al. 2005). Используя платформу GS20, разработанную 454 Life Sciences Corp., было получено 550 189 считываний последовательностей на общую сумму 60 миллионов оснований. Средняя длина чтения составила 108 баз (режим, 112 баз).Каждое считывание анализировали против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество считываний, которые соответствовали каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в β-глобиновом локусе, 72 взаимодействия в области генной пустыни и 451 межобластное взаимодействие. Данные обобщены в дополнительных таблицах 4 и 5.

Массово-параллельное решение для картирования взаимодействий между геномными элементами

Аннотация

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть идентифицированы с помощью хромосомы Методология Conformation Capture (3C).3C преобразует физические взаимодействия хроматина в конкретные продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микроматрицы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения. Мы применили 5C для анализа области 400 т.п.н., содержащей человеческий β-глобиновый локус и консервативную пустынную область гена размером 100 т.п.н. Мы подтвердили 5C путем обнаружения нескольких ранее идентифицированных петлевых взаимодействий в локусе β-глобина.Мы также идентифицировали новое петлевое взаимодействие в клетках K562 между контролирующей областью β-глобинового локуса и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетического переключения генов глобина. 5C должен быть широко применим для крупномасштабного картирования цис — и транс — сетей взаимодействия геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются активные усилия по картированию генов и регуляторных элементов по всему геному человека (ENCODE Project Consortium 2004).Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ только 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http://genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно нанести на карту все гены и функциональные элементы, а также определить все отношения между ними.Например, необходимо идентифицировать все регуляторные элементы каждого гена. Это усилие осложняется тем фактом, что геномные позиции генов и элементов не предоставляют прямой информации о функциональных отношениях между ними. Хорошо известный пример — энхансеры, которые могут регулировать несколько генов-мишеней, которые расположены на больших расстояниях генома или даже на разных хромосомах, не затрагивая гены, расположенные непосредственно рядом с ними (Spilianakis et al. 2005; West and Fraser 2005).

Недавние данные показывают, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямых физических взаимодействиях со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения показывают, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Таким образом, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами можно обнаружить с помощью метода захвата конформации хромосомы (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует сшивание формальдегидом для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Затем взаимодействующие элементы перевариваются рестрикционными ферментами и внутримолекулярно лигируются (). Частота лигирования двух рестрикционных фрагментов является мерой частоты, с которой они взаимодействуют в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотеку 3C генерируют с помощью обычного 3C, а затем преобразуют в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в мультиплексной установке. Затем библиотеки 5C анализируют на микрочипе или путем количественного секвенирования. ( B ) Дизайн праймера 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-конец, содержащий последовательность промотора Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину рестрикционного сайта. Все обратные праймеры содержат общий 3′-конец с комплементарной последовательностью Т3 (T3c) и фосфорилируются на 5′-конце. Прямой и обратный праймеры 5C отжигаются с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации дрожжевой хромосомы III (Dekker et al. 2002) и с тех пор применялся для анализа нескольких локусов млекопитающих, таких как β-глобиновый локус (Tolhuis et al.2002; Palstra et al. 2003; Vakoc et al. 2005), локус цитокинов Т-хелперов типа 2 (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом петля ДНК выходит наружу. 3C также использовался для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально связанными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005; Ling et al. 2006; Xu et al. 2006 г.). Вместе эти исследования предполагают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для обнаружения индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микроматрицы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует высоко мультиплексную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или путем количественного секвенирования ДНК.

5C был разработан и утвержден путем анализа человеческого β-глобинового локуса и консервативной области пустыни гена, расположенной на хромосоме человека 16. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий петель ДНК. Интересно, что анализ 5C также идентифицировал петлевое взаимодействие между β-globin Locus Control Region (LCR) и γ-δ межгенным регионом. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в клетках плода на экспрессию β-глобина во взрослых клетках (Calzolari et al.1999; Грибнау и др. 2000).

5C должен быть широко применим для определения связности цис и транс регуляторных элементов во всех крупных геномных областях. Кроме того, эксперименты 5C могут быть спроектированы таким образом, чтобы можно было создать полные карты взаимодействия для любой большой интересующей области генома, которые могут выявить местоположения новых регуляторных элементов генов, а также могут предоставить подробные сведения о сворачивании хромосом более высокого порядка.

Результаты

Метод 3C был подробно описан (Dekker et al.2002; Splinter et al. 2004; Vakoc et al. 2005; Dekker 2006; Miele et al. 2006) и проиллюстрирован в. Эксперимент 3C генерирует сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие по всему геному. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C частоты индивидуальных взаимодействий определяют путем количественной оценки образования предсказанных продуктов лигирования «голова к голове» с помощью полуколичественной ПЦР ().В качестве контроля ПЦР используется библиотека, содержащая все продукты лигирования в эквимолярных количествах. Контрольную библиотеку получают путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.

Краткое описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al. 1988; Li et al. 2005; Peck et al. 2006). Можно лигировать только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы на основе LMA являются количественными и могут выполняться на высоких уровнях мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al.2004; Бибикова и др. 2005; Hardenbol et al. 2005; Wang et al. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают на библиотеке 3C и лигируют. Используют два типа праймеров 5C: прямые 5C и обратные праймеры 5C. Эти праймеры сконструированы таким образом, что прямой и обратный праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (). Праймеры 5C, которые отжигаются рядом друг с другом, затем лигируют Taq-лигазой.На этом этапе создается библиотека 5C, которая амплифицируется с универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируют только тогда, когда оба отжигаются с конкретным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C образуются и как часто. В результате библиотека 5C представляет собой количественную «точную копию» части библиотеки 3C, как определено с помощью коллекции праймеров 5C.

Прямой и обратный праймеры 5C разработаны так, чтобы содержать уникальную последовательность, соответствующую смысловой и антисмысловой цепи 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. В дополнительном материале).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Для анализа взаимодействий между множеством рестрикционных фрагментов несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, только один праймер на каждый фрагмент, прямой или обратный, можно использовать в данном эксперименте 5С. Для облегчения лигирования все обратные праймеры фосфорилируются на своих 5′-концах.Эта конструкция праймера 5C позволяет одновременную амплификацию всех потенциальных взаимодействий между всеми фрагментами рестрикции, распознаваемыми прямым праймером, и всеми фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в человеческом β-глобиновом локусе

Мы разработали и оптимизировали подход 5C, проанализировав человеческий β-глобиновый локус. Этот локус был выбран потому, что несколько петлевых взаимодействий были ранее обнаружены 3C, а также вторым методом, RNA-TRAP (Carter et al.2002; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с использованием 5C можно использовать для проверки нового метода.

Человеческий β-глобиновый локус состоит из пяти онтогенетически регулируемых β-глобиноподобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, HBB . ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную перед кластером генов (). LCR характеризуется пятью сайтами гиперчувствительности к DNaseI (HS1-5) и необходим для тканеспецифической и независимой от положения экспрессии нижележащих β-глобиновых генов (Li et al.2002; Стаматояннопулос 2005). Предыдущий 3C анализ мышиного β-глобинового локуса выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). LCR, как было обнаружено, взаимодействует с элементами HS, расположенными выше (HS-62.5 / HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ человеческого β-глобинового локуса и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положение ГС обозначено черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»: «entrez-нуклеотид», «attrs»: {«text»: «BU661736», «term_id»: «23373918», «term_text»: «BU661736»} } BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью β-глобинового локуса.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось y указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение по крайней мере трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (S.E.M.). ( C ) Типичное титрование библиотеки 3C в одноплексном LMA с праймерами 5C. Возрастающие объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров гена пустыни 5C, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют собой S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено на 1. Каждое значение гистограммы представляет собой среднее значение по крайней мере трех ПЦР; полосы представляют собой S.E.M.

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя стандартный метод 3C. Локус анализировали в линии клеток эритролейкемии К562 и в линии лимфобластоидных клеток, трансформированных EBV, GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (Дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов ВАС (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и рестрикционными фрагментами EcoRI по всему β-глобиновому локусу определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействий, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, консервативной пустынной области гена на хромосоме 16 (область ENCODE ENr313) (Консорциум проектов ENCODE 2004 г.).

Нормализованные результаты представлены в. В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие из внутренней непосредственной близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлевых взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006 г.). Важно отметить, что случайные коллизии, по прогнозам, будут постепенно уменьшаться для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 высокие частоты взаимодействия наблюдались, в частности, между LCR и рестрикционным фрагментом, расположенным на ∼40 kb ниже и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения в субядерной локализации.

На основании этого анализа мы пришли к выводу, что конформация человеческого β-глобинового локуса сравнима с мышиным локусом с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в экспрессирующих глобин клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямого и обратного праймеров 5C, чтобы убедиться, что этот метод может количественно детектировать продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5C, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA выполняли с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (созданной из клеток K562), и образование лигированных прямого и обратного праймеров количественно оценивали с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается при наличии неспецифической ДНК, зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

Обнаружение LMA петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одноплексный LMA для количественного определения взаимодействий петель хроматина в β-глобиновом локусе. Мы сосредоточились на взаимодействиях с участием LCR и трех диагностических фрагментов в β-глобиновом локусе (обозначенных полосами): рестрикционного фрагмента, расположенного сразу после LCR, рестрикционного фрагмента, который перекрывает ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между генами δ- и β-глобина.Мы разработали обратный праймер 5C для рестрикционного фрагмента, перекрывающий HS5 LCR, и прямой 5C праймер для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с отдельными парами праймеров 5C в присутствии возрастающих количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнительная).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем расчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы обнаружили, что данные, полученные с помощью LMA, близко воспроизводят данные 3C, включая петлевое взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изученные здесь частоты взаимодействия (три в β-глобиновом локусе и одна в контрольной области) быть обнаружены и количественно определены в мультиплексной LMA-реакции.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы вычислили нормализованные частоты взаимодействия, как описано выше. Мы снова получили те же результаты, что и с обычным 3C (, правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием высоко мультиплексированного LMA

Для всестороннего 5C-анализа взаимодействий хроматина в крупных геномных областях потребуются высокие уровни мультиплексирования в сочетании с высокопроизводительным методом анализа 5C-библиотек.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и исследовали два высокопроизводительных метода обнаружения для анализа библиотек 5C: микроматрицы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех рестрикционных фрагментов EcoRI, которые перекрывают LCR, и прямые праймеры 5C для 55 рестрикционных фрагментов в области 400 т.п.н. вокруг LCR. Этот дизайн праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. Ниже).Мы также сконструировали 10 прямых праймеров 5C и 10 обратных праймеров 5C по всей области размером 100 т.п.н. в контрольной области генной пустыни. Прямой и обратный праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема конструирования праймеров позволяет обнаруживать матрицу взаимодействий по всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве шаблонов. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри β-глобинового локуса, 100 взаимодействий по всей генной пустыне и 590 взаимодействий между двумя геномными областями. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в. Мы использовали специфические праймеры для ПЦР для количественной оценки количества конкретных продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше.Мы обнаружили, что данные 5C близко воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнительная) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C повторяет профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина HS5 локуса β-глобина человека в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микроматрицы. Ось y указывает нормированные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а полосы ошибок представляют собой S.E.M. Схематическое изображение всего локуса представлено на вершине . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Планки погрешностей указывают стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчетов. Стандартные отклонения были распространены с использованием дельта-метода. ( D ) Корреляция между профилями 3C и 5C человеческих β-глобиновых локусов из клеток K562. Результаты 5C микроматрицы и секвенирования ДНК сравнивали с соответствующими данными 3C путем вычисления кратной разницы (логарифмическое соотношение 5C / 3C) для каждой пары взаимодействующих фрагментов (х-ось). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и путем количественного секвенирования

Мы проверили, можно ли использовать обнаружение микроматриц и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микроматрицы, мы амплифицировали библиотеки 5C, описанные выше, с универсальными праймерами, меченными Cy3.Помеченные библиотеки 5C затем гибридизовали с специально разработанным микрочипом, который может обнаруживать конкретные продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, которые разделяют один полусайт. Для оценки кросс-гибридизации на полусайтах микроматрица также содержала зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микроматрицы, которая допускает наименьшую перекрестную гибридизацию, на каждый зонд наносили пятно с 18 полусайтами различной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C были гибридизованы с массивом, и была определена специфическая гибридизация и гибридизация половинного сайта. Мы обнаружили, что зонды, которые состоят из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень перекрестной гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, и частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с помощью библиотеки 5C, на сигнал, полученный с помощью контрольной библиотеки (см. Ниже; дополнительную таблицу 7).

Крупномасштабный 5C-анализ человеческого β-глобинового локуса. ( A ) Положения прямого (, верхний, ) и обратный (, нижний, ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью 5C и микрочипов ( верхний ), 3C ( средний ) и 5C и анализа количественного секвенирования ( нижний ).Β-глобиновый локус, проиллюстрированный выше профилей, включает в себя особенности, описанные в. Направленная вперед стрелка указывает местоположение альтернативного сайта начала транскрипции ε-глобина. Светло-оранжевые и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелки указывают HS, идентифицированные в клетках K562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагалось, являются ортологами HS-62.5 / -62.0 в локусе мышей (Farrell et al.2002; Bulger et al. 2003). ( C ) Профиль взаимодействия хроматина HS2 / 3/4 LCR с областью 400 т.п.н. вокруг LCR, как определено с помощью микроматрицы ( вверху ) и количественного секвенирования ( внизу ). Цветные вертикальные полосы подчеркивают взаимодействия между LCR и вышележащими HSs и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C путем количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК, каждая из которых имеет длину ~ 100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул.Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микроматрицы, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки с помощью платформы GS20, разработанной 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160000 считываний последовательностей (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали количество раз, когда каждый конкретный продукт лигирования 5C был секвенирован (см. Методы; дополнительная таблица 5).Поскольку каждый продукт лигирования был секвенирован много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз секвенирования продукта 5C в библиотеке 5C на количество раз, которое он секвенировал в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ β-глобинового локуса

Сначала мы проанализировали профили взаимодействия HS5 по всему β-глобиновому локусу размером 100 т.п.н., обнаруженные на микрочипе () и с помощью количественного секвенирования ().Для сравнения, тот же профиль взаимодействия был также определен стандартным 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микроматрицы, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C β-глобинового локуса в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлевое взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-глобина, который слабо экспрессируется в клетках K562, но молчит в GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы сравнили наборы данных 5C и 3C напрямую, вычислив для каждой пары взаимодействующих фрагментов кратную разницу между их частотами взаимодействия, определенную с помощью 5C и 3C.Мы обнаружили, что разница в данных 5C, полученных с помощью обнаружения микроматрицы и обычного 3C, обычно меньше двух раз (). Однако большие различия наблюдались при сравнении данных 5C, полученных путем количественного секвенирования, с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном путем секвенирования, по сравнению с полуколичественным ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на диаграмму рассеяния (Дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием, и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации гена пустынной контрольной области. ( A ) Положения чередующихся 5C прямого ( верхний ) и обратный ( нижний ) праймеров по всей контрольной области генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( левая панель ), 5C и микрочипов ( средняя панель ), а также 5C и количественного секвенирования ( правая панель ). Частоты взаимодействия представлены в зависимости от геномного расстояния между взаимодействующими фрагментами. Полоски представляют собой S.E.M. Частоты взаимодействия, обнаруженные в ячейках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание: праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с этими праймерами, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

Взятые вместе, эти результаты обеспечивают четкое доказательство принципа того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой производительности. .

Взаимодействия между HS5 и вышележащими элементами

LCR мыши взаимодействует с HS элементами (HS-62.5 / HS-60), расположенными на расстоянии до 40 kb выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли функционально эквивалентные взаимодействующие элементы в этой области генома человека. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.н. выше LCR, ортологичны генам, расположенным на 40 т.п.н. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области связаны.Кроме того, мышиный элемент HS-62.5 / HS-60 встроен в последовательность, аналогичную последовательности, расположенной на 90 т.п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная на ~ 90 т.п.н. выше LCR человека, является ортологичной области, расположенной на ~ 40 т.п.н. выше локуса мыши, предполагая, что эта область может также взаимодействовать с LCR в человеческих клетках. Чтобы объективно оценить, взаимодействует ли LCR с какими-либо вышестоящими элементами в локусе человека, описанный выше эксперимент 5C был разработан, чтобы включить анализ большой области, расположенной перед LCR.

Мы проанализировали профили взаимодействия, полученные с помощью обнаружения на микрочипах и количественного секвенирования HS5 с областью до 280 т.п.н. перед LCR. Оба набора данных показали, что взаимодействия во всей этой области обычно намного ниже, чем наблюдаемые между LCR и β-глобиновым локусом. Однако в обеих клеточных линиях мы действительно обнаружили повышенные частоты взаимодействия во всем большом домене, расположенном на 50–100 kb выше LCR (). Этот результат был подтвержден традиционным анализом 3C (см.верхняя, средняя и нижняя панели). Эта область содержит три гена обонятельных рецепторов и множество сайтов HS (Bulger et al. 2003).

Эти результаты предполагают, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в локусе мыши. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местоположения новых предполагаемых регуляторных элементов.

Параллельный анализ множественных профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между множественными интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, прямой и обратный праймеры 5C были разработаны для одновременного обнаружения профилей взаимодействия каждой из трех субсекций LCR с 400 т.п.н. окружающего хроматина.Данные, полученные с помощью микроматричного анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2 / 3/4 фрагмента LCR, очень похож на профиль HS5 (). Интересно, что мы обнаружили, что в клетках K562 HS2 / 3/4 чаще взаимодействует с сайтами по всему β-глобиновому локусу, чем HS5, подтверждая, что эти HSs могут вносить наибольший вклад в формирование петель хроматина с LCR. Анализ 5C 3′-конца LCR, который содержит HS1, не дал достаточных уровней продуктов лигирования для получения значительного числа считываний последовательности.Анализ сигналов гибридизации микроматрицы подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали паттернам, полученным для HS5 и HS2 / 3/4 (дополнительная таблица 7 ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ β-глобинового локуса был сфокусирован на картировании взаимодействий между фиксированным регуляторным элементом, LCR и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов определены плохо. Здесь мы приводим пример альтернативной схемы конструирования праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Описанный выше 5C-анализ включал 10 прямых и 10 обратных 5C-праймеров для рестрикционных фрагментов, расположенных в контрольной области генной пустыни (). Важно отметить, что прямой и обратный праймеры были разработаны для чередования рестрикционных фрагментов ().В совокупности эти праймеры выявляли взаимодействия хроматина во всем регионе. Частоты взаимодействия, определенные с помощью анализа микрочипов и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействия снижается с увеличением геномного расстояния (). Аналогичные результаты были получены с помощью обычного анализа 3C.

Графики не показывают, где вдоль хромосомы были измерены определенные частоты взаимодействия.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямым и обратным праймерами 5C в виде двумерных тепловых карт, на которых цвет каждого квадрата является показателем частоты взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этой генной пустынной области, очень отличается от наблюдаемого в β-глобиновом локусе и согласуется с поведением хаотической спирали хроматинового волокна без дальнодействующих петлевых взаимодействий (Rippe 2001; Dekker et al.2002; Деккер 2006).

Обсуждение

Разработка 3C значительно облегчила обнаружение и изучение взаимодействий цис и транс между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить диапазон приложений 3C, позволяя комплексное и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа β-глобинового локуса

Мы проверили 5C путем обнаружения взаимодействий петель хроматина в человеческом β-глобиновом локусе. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессируемыми генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в GM06990, LCR также взаимодействует с 3′-HS1 элементом и большим доменом, расположенным на 50–100 kb выше. Последняя область соответствует области вокруг HS-62.5 / HS-60 в локусе мышей (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HSs была предложена для создания хроматинового концентратора или специализированного ядерного компартмента, предназначенного для транскрипции β-глобиновых генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые HS в β-глобиновом локусе связывают инсулятор-связывающий белок CTCF (Farrell et al., 2002; Bulger et al., 2003) (а для HS5 человека см. Дополнительный рис.6), и было предложено, что этот белок опосредует их взаимодействия и образование хаба хроматина (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых из элементов не влияет напрямую на экспрессию β-глобина (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они не могут напрямую регулировать экспрессию β-глобина, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2 / 3/4 очень похожи, за исключением того, что HS2 / 3/4 чаще взаимодействует с β-глобиновым локусом, особенно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al. 1993; Peterson et al. 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген глобина наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое взаимодействие петель хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что этот регион участвует в контроле развития β-глобинового локуса (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнительная информация), что позволяет предположить, что петлевое взаимодействие может участвовать в активации транскрипции. Эта область также содержит промотор для большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-глобина (Gribnau et al. 2000).Некоторые пациенты, которые страдают от наследственной персистенции гемоглобина плода, несут делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al. 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными областями γ – δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенной области, несмотря на присутствие несколько слабых предполагаемых сайтов связывания CTCF (дополнительный рис. 6).

Обнаружение микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования микроматриц, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также заметили несколько отличий. Во-первых, динамический диапазон обнаружения микроматрицы был меньше, чем у количественного секвенирования, как наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученными с помощью микроматричного анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ – δ (рис.). Эти различия могут отражать внутренние предубеждения в методах обнаружения, но также могут быть связаны с экспериментальными вариациями между независимо созданными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает больший динамический диапазон и устраняет необходимость в создании определенного массива для каждой интересующей области генома. С другой стороны, микроматричный анализ в настоящее время более рентабелен, особенно когда конкретная область генома должна быть проанализирована в большом количестве различных условий.

Данные 5C, полученные путем секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно определили 451 взаимодействие между β-глобиновым локусом и пустынной областью контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-глобина и область генной пустыни должны преимущественно взаимодействовать. Поэтому мы предположили, что эти частоты межхромосомного взаимодействия будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие частоты фонового взаимодействия между двумя регионами (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2 / 3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймеров или экспериментальный шум. Будущие крупномасштабные анализы 5C предоставят более подробное представление об этих проблемах.

Приложения 5C

5C полагается на мультиплексную амплификацию, опосредованную лигированием, и, таким образом, потенциально ограничивается количеством праймеров 5C, которые могут использоваться в одной реакции.В других анализах, основанных на LMA, в одной реакции успешно использовались многие тысячи праймеров. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси ∼6000 праймеров (Бибикова и др., 2005). Другим примером является использование высоко мультиплексированных LMA с до 20 000 зондов молекулярной инверсии в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10000 праймеров 5C в одном эксперименте, до 25 миллионов различных взаимодействий хроматина могут быть обнаружены параллельно с участием до 40 МБ (10000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для высоко мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые были использованы для создания проанализированных здесь библиотек 5C, прекрасно распознали многочисленные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы ожидаем два типа приложений 5C, которые различаются схемами разработки праймеров 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными интересующими элементами генома, подобно анализу локуса β-глобина, описанному здесь.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис или в транс , чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов, параллельно в одной реакции, с последующим анализом на специально разработанной микроматрице или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого интересующего фиксированного фрагмента, а прямые праймеры 5C конструируют для всех других рестрикционных фрагментов, как показано на.Этот тип анализа позволит быстро обнаруживать сети взаимодействий между множеством генов и регуляторных элементов в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействий, которые охватывают большую часть или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямой и обратный праймеры 5C разработаны для чередования рестрикционных фрагментов, как это выполнено здесь для контрольной области генной пустыни (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой 5C-анализ не предоставит полную карту взаимодействий для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются прямыми праймерами или обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с перестановкой схемы конструирования праймеров 5C для получения частично перекрывающихся матриц взаимодействий. В сочетании эти карты могут дать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будут соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействий может использоваться в качестве инструмента открытия для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействий может также предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Селекция ВАС и подготовка контрольной библиотеки

Контрольная библиотека для человеческого β-глобинового локуса и пустынных областей гена (области ENCODE ENm009 и ENr313, соответственно) была создана, как описано (Dekker 2006; Miele et al.2006 г.). Вкратце, набор бактериальных искусственных хромосом (ВАС), покрывающих обе области генома, смешивали, переваривали с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы ВАС из локуса β-глобина и областей пустыни гена были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Следующие семь клонов ВАС использовали для области β-глобина: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов ВАС был выбран для покрытия пустынной области гена 0,5 Mb и включал RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Исследовательского института Детской больницы Окленда (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из EBV-трансформированных B-лимфоцитов и была получена из Coriell Cell Repositories (CCR). Эту клеточную линию культивировали в среде 1640 Roswell Park Memorial Institute (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37 ° C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C выполняли с лог-фазой клеток GM06990 и K562 с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Общую РНК из клеток в логарифмической фазе выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго (dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно оценивали с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические человеческие праймеры β-глобина, использованные в этом анализе, суммированы в дополнительной таблице 1.

Дизайн праймера 5C

Прямой и обратный праймеры были сконструированы для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI.Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления составляла 72 ° C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были сконструированы так, чтобы включать 5′-конец хвоста, который включает (5’– 3 ‘) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированная последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были сконструированы так, чтобы включать 3’-конец хвоста, который включает (5’– 3 ‘) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5C каждый содержали половину сайта рестрикции EcoRI, и только обратные праймеры фосфорилировались на 5’-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотека 3C (представляющая около 150 000 копий генома) или контрольная библиотека (5 нг) была смешана с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ DTT). Образцы денатурировали 5 мин при 95 ° C и отжигали 16 ч при 48 ° C. Отожженные праймеры лигировали в течение 1 ч при 48 ° C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при pH 7,6, 31,25 мМ ацетат калия, 12,5 мМ ацетат магния, 1,25 мМ NAD, 12,5 мМ DTT, 0,125% Triton X -100), содержащий 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65 ° C в течение 10 мин. Продукты лигирования 5C амплифицировали с помощью ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в реакциях ПЦР объемом 25 мкл (32 цикла по 30 секунд денатурирования при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C. ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления не включенных праймеров и других загрязняющих веществ в соответствии с рекомендациями производителя.

Одноплексный и шестиплексный анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~ 150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировались на 35 Циклы ПЦР: 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали с помощью бромистого этидия (0,5 мкг / мл). Sixplex 5C анализ выполняли путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C образцов из шести комплексов детектировали с помощью ПЦР со специфическими внутренними праймерами ПЦР и измеряли на агарозных гелях, как описано выше. ПЦР-детекция продуктов 5C с линейным диапазоном была подтверждена путем двукратного серийного титрования мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микроматрицы библиотеки 5C

Библиотеки 5C были получены путем выполнения множественной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченным праймером обратной ПЦР, комплементарным общей последовательности 3′-конца обратных праймеров 5C (Cy3 -T3modif). Синтез и гибридизация без масок проводились с использованием 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al. 1999; Nuwaysir et al. 2002; Kim et al. 2005; Selzer et al.2005). Каждый массив содержал смысловую цепь предсказанных продуктов лигирования 5C. Матрицы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов с увеличивающейся длиной признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зондов массива (Дополнение). Полное описание конструкции массива доступно по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp.) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Библиотека 5C Анализ высокопроизводительного секвенирования ДНК

Библиотеки 5C были созданы с 73 праймерами 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с 5′-концевыми фосфорилированными праймерами для ПЦР и обрабатывали для пиросеквенирования одной молекулы, как описано ранее (Margulies et al. 2005). Используя платформу GS20, разработанную 454 Life Sciences Corp., было получено 550 189 считываний последовательностей на общую сумму 60 миллионов оснований. Средняя длина чтения составила 108 баз (режим, 112 баз).Каждое считывание анализировали против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество считываний, которые соответствовали каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в β-глобиновом локусе, 72 взаимодействия в области генной пустыни и 451 межобластное взаимодействие. Данные обобщены в дополнительных таблицах 4 и 5.

Массово-параллельное решение для картирования взаимодействий между геномными элементами

Аннотация

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть идентифицированы с помощью хромосомы Методология Conformation Capture (3C).3C преобразует физические взаимодействия хроматина в конкретные продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микроматрицы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения. Мы применили 5C для анализа области 400 т.п.н., содержащей человеческий β-глобиновый локус и консервативную пустынную область гена размером 100 т.п.н. Мы подтвердили 5C путем обнаружения нескольких ранее идентифицированных петлевых взаимодействий в локусе β-глобина.Мы также идентифицировали новое петлевое взаимодействие в клетках K562 между контролирующей областью β-глобинового локуса и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетического переключения генов глобина. 5C должен быть широко применим для крупномасштабного картирования цис — и транс — сетей взаимодействия геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются активные усилия по картированию генов и регуляторных элементов по всему геному человека (ENCODE Project Consortium 2004).Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ только 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http://genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно нанести на карту все гены и функциональные элементы, а также определить все отношения между ними.Например, необходимо идентифицировать все регуляторные элементы каждого гена. Это усилие осложняется тем фактом, что геномные позиции генов и элементов не предоставляют прямой информации о функциональных отношениях между ними. Хорошо известный пример — энхансеры, которые могут регулировать несколько генов-мишеней, которые расположены на больших расстояниях генома или даже на разных хромосомах, не затрагивая гены, расположенные непосредственно рядом с ними (Spilianakis et al. 2005; West and Fraser 2005).

Недавние данные показывают, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямых физических взаимодействиях со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения показывают, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Таким образом, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами можно обнаружить с помощью метода захвата конформации хромосомы (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует сшивание формальдегидом для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Затем взаимодействующие элементы перевариваются рестрикционными ферментами и внутримолекулярно лигируются (). Частота лигирования двух рестрикционных фрагментов является мерой частоты, с которой они взаимодействуют в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотеку 3C генерируют с помощью обычного 3C, а затем преобразуют в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в мультиплексной установке. Затем библиотеки 5C анализируют на микрочипе или путем количественного секвенирования. ( B ) Дизайн праймера 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-конец, содержащий последовательность промотора Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину рестрикционного сайта. Все обратные праймеры содержат общий 3′-конец с комплементарной последовательностью Т3 (T3c) и фосфорилируются на 5′-конце. Прямой и обратный праймеры 5C отжигаются с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации дрожжевой хромосомы III (Dekker et al. 2002) и с тех пор применялся для анализа нескольких локусов млекопитающих, таких как β-глобиновый локус (Tolhuis et al.2002; Palstra et al. 2003; Vakoc et al. 2005), локус цитокинов Т-хелперов типа 2 (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом петля ДНК выходит наружу. 3C также использовался для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально связанными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005; Ling et al. 2006; Xu et al. 2006 г.). Вместе эти исследования предполагают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для обнаружения индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микроматрицы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует высоко мультиплексную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или путем количественного секвенирования ДНК.

5C был разработан и утвержден путем анализа человеческого β-глобинового локуса и консервативной области пустыни гена, расположенной на хромосоме человека 16. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий петель ДНК. Интересно, что анализ 5C также идентифицировал петлевое взаимодействие между β-globin Locus Control Region (LCR) и γ-δ межгенным регионом. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в клетках плода на экспрессию β-глобина во взрослых клетках (Calzolari et al.1999; Грибнау и др. 2000).

5C должен быть широко применим для определения связности цис и транс регуляторных элементов во всех крупных геномных областях. Кроме того, эксперименты 5C могут быть спроектированы таким образом, чтобы можно было создать полные карты взаимодействия для любой большой интересующей области генома, которые могут выявить местоположения новых регуляторных элементов генов, а также могут предоставить подробные сведения о сворачивании хромосом более высокого порядка.

Результаты

Метод 3C был подробно описан (Dekker et al.2002; Splinter et al. 2004; Vakoc et al. 2005; Dekker 2006; Miele et al. 2006) и проиллюстрирован в. Эксперимент 3C генерирует сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие по всему геному. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C частоты индивидуальных взаимодействий определяют путем количественной оценки образования предсказанных продуктов лигирования «голова к голове» с помощью полуколичественной ПЦР ().В качестве контроля ПЦР используется библиотека, содержащая все продукты лигирования в эквимолярных количествах. Контрольную библиотеку получают путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.

Краткое описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al. 1988; Li et al. 2005; Peck et al. 2006). Можно лигировать только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы на основе LMA являются количественными и могут выполняться на высоких уровнях мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al.2004; Бибикова и др. 2005; Hardenbol et al. 2005; Wang et al. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают на библиотеке 3C и лигируют. Используют два типа праймеров 5C: прямые 5C и обратные праймеры 5C. Эти праймеры сконструированы таким образом, что прямой и обратный праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (). Праймеры 5C, которые отжигаются рядом друг с другом, затем лигируют Taq-лигазой.На этом этапе создается библиотека 5C, которая амплифицируется с универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируют только тогда, когда оба отжигаются с конкретным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C образуются и как часто. В результате библиотека 5C представляет собой количественную «точную копию» части библиотеки 3C, как определено с помощью коллекции праймеров 5C.

Прямой и обратный праймеры 5C разработаны так, чтобы содержать уникальную последовательность, соответствующую смысловой и антисмысловой цепи 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. В дополнительном материале).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Для анализа взаимодействий между множеством рестрикционных фрагментов несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, только один праймер на каждый фрагмент, прямой или обратный, можно использовать в данном эксперименте 5С. Для облегчения лигирования все обратные праймеры фосфорилируются на своих 5′-концах.Эта конструкция праймера 5C позволяет одновременную амплификацию всех потенциальных взаимодействий между всеми фрагментами рестрикции, распознаваемыми прямым праймером, и всеми фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в человеческом β-глобиновом локусе

Мы разработали и оптимизировали подход 5C, проанализировав человеческий β-глобиновый локус. Этот локус был выбран потому, что несколько петлевых взаимодействий были ранее обнаружены 3C, а также вторым методом, RNA-TRAP (Carter et al.2002; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с использованием 5C можно использовать для проверки нового метода.

Человеческий β-глобиновый локус состоит из пяти онтогенетически регулируемых β-глобиноподобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, HBB . ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную перед кластером генов (). LCR характеризуется пятью сайтами гиперчувствительности к DNaseI (HS1-5) и необходим для тканеспецифической и независимой от положения экспрессии нижележащих β-глобиновых генов (Li et al.2002; Стаматояннопулос 2005). Предыдущий 3C анализ мышиного β-глобинового локуса выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). LCR, как было обнаружено, взаимодействует с элементами HS, расположенными выше (HS-62.5 / HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ человеческого β-глобинового локуса и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положение ГС обозначено черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»: «entrez-нуклеотид», «attrs»: {«text»: «BU661736», «term_id»: «23373918», «term_text»: «BU661736»} } BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью β-глобинового локуса.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось y указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение по крайней мере трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (S.E.M.). ( C ) Типичное титрование библиотеки 3C в одноплексном LMA с праймерами 5C. Возрастающие объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров гена пустыни 5C, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют собой S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено на 1. Каждое значение гистограммы представляет собой среднее значение по крайней мере трех ПЦР; полосы представляют собой S.E.M.

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя стандартный метод 3C. Локус анализировали в линии клеток эритролейкемии К562 и в линии лимфобластоидных клеток, трансформированных EBV, GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (Дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов ВАС (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и рестрикционными фрагментами EcoRI по всему β-глобиновому локусу определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействий, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, консервативной пустынной области гена на хромосоме 16 (область ENCODE ENr313) (Консорциум проектов ENCODE 2004 г.).

Нормализованные результаты представлены в. В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие из внутренней непосредственной близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлевых взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006 г.). Важно отметить, что случайные коллизии, по прогнозам, будут постепенно уменьшаться для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 высокие частоты взаимодействия наблюдались, в частности, между LCR и рестрикционным фрагментом, расположенным на ∼40 kb ниже и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения в субядерной локализации.

На основании этого анализа мы пришли к выводу, что конформация человеческого β-глобинового локуса сравнима с мышиным локусом с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в экспрессирующих глобин клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямого и обратного праймеров 5C, чтобы убедиться, что этот метод может количественно детектировать продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5C, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA выполняли с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (созданной из клеток K562), и образование лигированных прямого и обратного праймеров количественно оценивали с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается при наличии неспецифической ДНК, зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

Обнаружение LMA петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одноплексный LMA для количественного определения взаимодействий петель хроматина в β-глобиновом локусе. Мы сосредоточились на взаимодействиях с участием LCR и трех диагностических фрагментов в β-глобиновом локусе (обозначенных полосами): рестрикционного фрагмента, расположенного сразу после LCR, рестрикционного фрагмента, который перекрывает ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между генами δ- и β-глобина.Мы разработали обратный праймер 5C для рестрикционного фрагмента, перекрывающий HS5 LCR, и прямой 5C праймер для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с отдельными парами праймеров 5C в присутствии возрастающих количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнительная).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем расчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы обнаружили, что данные, полученные с помощью LMA, близко воспроизводят данные 3C, включая петлевое взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изученные здесь частоты взаимодействия (три в β-глобиновом локусе и одна в контрольной области) быть обнаружены и количественно определены в мультиплексной LMA-реакции.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы вычислили нормализованные частоты взаимодействия, как описано выше. Мы снова получили те же результаты, что и с обычным 3C (, правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием высоко мультиплексированного LMA

Для всестороннего 5C-анализа взаимодействий хроматина в крупных геномных областях потребуются высокие уровни мультиплексирования в сочетании с высокопроизводительным методом анализа 5C-библиотек.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и исследовали два высокопроизводительных метода обнаружения для анализа библиотек 5C: микроматрицы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех рестрикционных фрагментов EcoRI, которые перекрывают LCR, и прямые праймеры 5C для 55 рестрикционных фрагментов в области 400 т.п.н. вокруг LCR. Этот дизайн праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. Ниже).Мы также сконструировали 10 прямых праймеров 5C и 10 обратных праймеров 5C по всей области размером 100 т.п.н. в контрольной области генной пустыни. Прямой и обратный праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема конструирования праймеров позволяет обнаруживать матрицу взаимодействий по всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве шаблонов. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри β-глобинового локуса, 100 взаимодействий по всей генной пустыне и 590 взаимодействий между двумя геномными областями. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в. Мы использовали специфические праймеры для ПЦР для количественной оценки количества конкретных продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше.Мы обнаружили, что данные 5C близко воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнительная) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C повторяет профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина HS5 локуса β-глобина человека в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микроматрицы. Ось y указывает нормированные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а полосы ошибок представляют собой S.E.M. Схематическое изображение всего локуса представлено на вершине . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Планки погрешностей указывают стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчетов. Стандартные отклонения были распространены с использованием дельта-метода. ( D ) Корреляция между профилями 3C и 5C человеческих β-глобиновых локусов из клеток K562. Результаты 5C микроматрицы и секвенирования ДНК сравнивали с соответствующими данными 3C путем вычисления кратной разницы (логарифмическое соотношение 5C / 3C) для каждой пары взаимодействующих фрагментов (х-ось). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и путем количественного секвенирования

Мы проверили, можно ли использовать обнаружение микроматриц и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микроматрицы, мы амплифицировали библиотеки 5C, описанные выше, с универсальными праймерами, меченными Cy3.Помеченные библиотеки 5C затем гибридизовали с специально разработанным микрочипом, который может обнаруживать конкретные продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, которые разделяют один полусайт. Для оценки кросс-гибридизации на полусайтах микроматрица также содержала зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микроматрицы, которая допускает наименьшую перекрестную гибридизацию, на каждый зонд наносили пятно с 18 полусайтами различной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C были гибридизованы с массивом, и была определена специфическая гибридизация и гибридизация половинного сайта. Мы обнаружили, что зонды, которые состоят из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень перекрестной гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, и частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с помощью библиотеки 5C, на сигнал, полученный с помощью контрольной библиотеки (см. Ниже; дополнительную таблицу 7).

Крупномасштабный 5C-анализ человеческого β-глобинового локуса. ( A ) Положения прямого (, верхний, ) и обратный (, нижний, ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью 5C и микрочипов ( верхний ), 3C ( средний ) и 5C и анализа количественного секвенирования ( нижний ).Β-глобиновый локус, проиллюстрированный выше профилей, включает в себя особенности, описанные в. Направленная вперед стрелка указывает местоположение альтернативного сайта начала транскрипции ε-глобина. Светло-оранжевые и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелки указывают HS, идентифицированные в клетках K562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагалось, являются ортологами HS-62.5 / -62.0 в локусе мышей (Farrell et al.2002; Bulger et al. 2003). ( C ) Профиль взаимодействия хроматина HS2 / 3/4 LCR с областью 400 т.п.н. вокруг LCR, как определено с помощью микроматрицы ( вверху ) и количественного секвенирования ( внизу ). Цветные вертикальные полосы подчеркивают взаимодействия между LCR и вышележащими HSs и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C путем количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК, каждая из которых имеет длину ~ 100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул.Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микроматрицы, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки с помощью платформы GS20, разработанной 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160000 считываний последовательностей (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали количество раз, когда каждый конкретный продукт лигирования 5C был секвенирован (см. Методы; дополнительная таблица 5).Поскольку каждый продукт лигирования был секвенирован много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз секвенирования продукта 5C в библиотеке 5C на количество раз, которое он секвенировал в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ β-глобинового локуса

Сначала мы проанализировали профили взаимодействия HS5 по всему β-глобиновому локусу размером 100 т.п.н., обнаруженные на микрочипе () и с помощью количественного секвенирования ().Для сравнения, тот же профиль взаимодействия был также определен стандартным 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микроматрицы, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C β-глобинового локуса в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлевое взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-глобина, который слабо экспрессируется в клетках K562, но молчит в GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы сравнили наборы данных 5C и 3C напрямую, вычислив для каждой пары взаимодействующих фрагментов кратную разницу между их частотами взаимодействия, определенную с помощью 5C и 3C.Мы обнаружили, что разница в данных 5C, полученных с помощью обнаружения микроматрицы и обычного 3C, обычно меньше двух раз (). Однако большие различия наблюдались при сравнении данных 5C, полученных путем количественного секвенирования, с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном путем секвенирования, по сравнению с полуколичественным ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на диаграмму рассеяния (Дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием, и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации гена пустынной контрольной области. ( A ) Положения чередующихся 5C прямого ( верхний ) и обратный ( нижний ) праймеров по всей контрольной области генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( левая панель ), 5C и микрочипов ( средняя панель ), а также 5C и количественного секвенирования ( правая панель ). Частоты взаимодействия представлены в зависимости от геномного расстояния между взаимодействующими фрагментами. Полоски представляют собой S.E.M. Частоты взаимодействия, обнаруженные в ячейках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание: праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с этими праймерами, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

Взятые вместе, эти результаты обеспечивают четкое доказательство принципа того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой производительности. .

Взаимодействия между HS5 и вышележащими элементами

LCR мыши взаимодействует с HS элементами (HS-62.5 / HS-60), расположенными на расстоянии до 40 kb выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли функционально эквивалентные взаимодействующие элементы в этой области генома человека. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.н. выше LCR, ортологичны генам, расположенным на 40 т.п.н. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области связаны.Кроме того, мышиный элемент HS-62.5 / HS-60 встроен в последовательность, аналогичную последовательности, расположенной на 90 т.п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная на ~ 90 т.п.н. выше LCR человека, является ортологичной области, расположенной на ~ 40 т.п.н. выше локуса мыши, предполагая, что эта область может также взаимодействовать с LCR в человеческих клетках. Чтобы объективно оценить, взаимодействует ли LCR с какими-либо вышестоящими элементами в локусе человека, описанный выше эксперимент 5C был разработан, чтобы включить анализ большой области, расположенной перед LCR.

Мы проанализировали профили взаимодействия, полученные с помощью обнаружения на микрочипах и количественного секвенирования HS5 с областью до 280 т.п.н. перед LCR. Оба набора данных показали, что взаимодействия во всей этой области обычно намного ниже, чем наблюдаемые между LCR и β-глобиновым локусом. Однако в обеих клеточных линиях мы действительно обнаружили повышенные частоты взаимодействия во всем большом домене, расположенном на 50–100 kb выше LCR (). Этот результат был подтвержден традиционным анализом 3C (см.верхняя, средняя и нижняя панели). Эта область содержит три гена обонятельных рецепторов и множество сайтов HS (Bulger et al. 2003).

Эти результаты предполагают, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в локусе мыши. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местоположения новых предполагаемых регуляторных элементов.

Параллельный анализ множественных профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между множественными интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, прямой и обратный праймеры 5C были разработаны для одновременного обнаружения профилей взаимодействия каждой из трех субсекций LCR с 400 т.п.н. окружающего хроматина.Данные, полученные с помощью микроматричного анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2 / 3/4 фрагмента LCR, очень похож на профиль HS5 (). Интересно, что мы обнаружили, что в клетках K562 HS2 / 3/4 чаще взаимодействует с сайтами по всему β-глобиновому локусу, чем HS5, подтверждая, что эти HSs могут вносить наибольший вклад в формирование петель хроматина с LCR. Анализ 5C 3′-конца LCR, который содержит HS1, не дал достаточных уровней продуктов лигирования для получения значительного числа считываний последовательности.Анализ сигналов гибридизации микроматрицы подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали паттернам, полученным для HS5 и HS2 / 3/4 (дополнительная таблица 7 ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ β-глобинового локуса был сфокусирован на картировании взаимодействий между фиксированным регуляторным элементом, LCR и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов определены плохо. Здесь мы приводим пример альтернативной схемы конструирования праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Описанный выше 5C-анализ включал 10 прямых и 10 обратных 5C-праймеров для рестрикционных фрагментов, расположенных в контрольной области генной пустыни (). Важно отметить, что прямой и обратный праймеры были разработаны для чередования рестрикционных фрагментов ().В совокупности эти праймеры выявляли взаимодействия хроматина во всем регионе. Частоты взаимодействия, определенные с помощью анализа микрочипов и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействия снижается с увеличением геномного расстояния (). Аналогичные результаты были получены с помощью обычного анализа 3C.

Графики не показывают, где вдоль хромосомы были измерены определенные частоты взаимодействия.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямым и обратным праймерами 5C в виде двумерных тепловых карт, на которых цвет каждого квадрата является показателем частоты взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этой генной пустынной области, очень отличается от наблюдаемого в β-глобиновом локусе и согласуется с поведением хаотической спирали хроматинового волокна без дальнодействующих петлевых взаимодействий (Rippe 2001; Dekker et al.2002; Деккер 2006).

Обсуждение

Разработка 3C значительно облегчила обнаружение и изучение взаимодействий цис и транс между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить диапазон приложений 3C, позволяя комплексное и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа β-глобинового локуса

Мы проверили 5C путем обнаружения взаимодействий петель хроматина в человеческом β-глобиновом локусе. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессируемыми генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в GM06990, LCR также взаимодействует с 3′-HS1 элементом и большим доменом, расположенным на 50–100 kb выше. Последняя область соответствует области вокруг HS-62.5 / HS-60 в локусе мышей (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HSs была предложена для создания хроматинового концентратора или специализированного ядерного компартмента, предназначенного для транскрипции β-глобиновых генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые HS в β-глобиновом локусе связывают инсулятор-связывающий белок CTCF (Farrell et al., 2002; Bulger et al., 2003) (а для HS5 человека см. Дополнительный рис.6), и было предложено, что этот белок опосредует их взаимодействия и образование хаба хроматина (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых из элементов не влияет напрямую на экспрессию β-глобина (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они не могут напрямую регулировать экспрессию β-глобина, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2 / 3/4 очень похожи, за исключением того, что HS2 / 3/4 чаще взаимодействует с β-глобиновым локусом, особенно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al. 1993; Peterson et al. 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген глобина наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое взаимодействие петель хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что этот регион участвует в контроле развития β-глобинового локуса (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнительная информация), что позволяет предположить, что петлевое взаимодействие может участвовать в активации транскрипции. Эта область также содержит промотор для большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-глобина (Gribnau et al. 2000).Некоторые пациенты, которые страдают от наследственной персистенции гемоглобина плода, несут делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al. 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными областями γ – δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенной области, несмотря на присутствие несколько слабых предполагаемых сайтов связывания CTCF (дополнительный рис. 6).

Обнаружение микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования микроматриц, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также заметили несколько отличий. Во-первых, динамический диапазон обнаружения микроматрицы был меньше, чем у количественного секвенирования, как наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученными с помощью микроматричного анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ – δ (рис.). Эти различия могут отражать внутренние предубеждения в методах обнаружения, но также могут быть связаны с экспериментальными вариациями между независимо созданными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает больший динамический диапазон и устраняет необходимость в создании определенного массива для каждой интересующей области генома. С другой стороны, микроматричный анализ в настоящее время более рентабелен, особенно когда конкретная область генома должна быть проанализирована в большом количестве различных условий.

Данные 5C, полученные путем секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно определили 451 взаимодействие между β-глобиновым локусом и пустынной областью контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-глобина и область генной пустыни должны преимущественно взаимодействовать. Поэтому мы предположили, что эти частоты межхромосомного взаимодействия будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие частоты фонового взаимодействия между двумя регионами (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2 / 3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймеров или экспериментальный шум. Будущие крупномасштабные анализы 5C предоставят более подробное представление об этих проблемах.

Приложения 5C

5C полагается на мультиплексную амплификацию, опосредованную лигированием, и, таким образом, потенциально ограничивается количеством праймеров 5C, которые могут использоваться в одной реакции.В других анализах, основанных на LMA, в одной реакции успешно использовались многие тысячи праймеров. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси ∼6000 праймеров (Бибикова и др., 2005). Другим примером является использование высоко мультиплексированных LMA с до 20 000 зондов молекулярной инверсии в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10000 праймеров 5C в одном эксперименте, до 25 миллионов различных взаимодействий хроматина могут быть обнаружены параллельно с участием до 40 МБ (10000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для высоко мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые были использованы для создания проанализированных здесь библиотек 5C, прекрасно распознали многочисленные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы ожидаем два типа приложений 5C, которые различаются схемами разработки праймеров 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными интересующими элементами генома, подобно анализу локуса β-глобина, описанному здесь.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис или в транс , чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов, параллельно в одной реакции, с последующим анализом на специально разработанной микроматрице или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого интересующего фиксированного фрагмента, а прямые праймеры 5C конструируют для всех других рестрикционных фрагментов, как показано на.Этот тип анализа позволит быстро обнаруживать сети взаимодействий между множеством генов и регуляторных элементов в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействий, которые охватывают большую часть или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямой и обратный праймеры 5C разработаны для чередования рестрикционных фрагментов, как это выполнено здесь для контрольной области генной пустыни (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой 5C-анализ не предоставит полную карту взаимодействий для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются прямыми праймерами или обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с перестановкой схемы конструирования праймеров 5C для получения частично перекрывающихся матриц взаимодействий. В сочетании эти карты могут дать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будут соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействий может использоваться в качестве инструмента открытия для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействий может также предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Селекция ВАС и подготовка контрольной библиотеки

Контрольная библиотека для человеческого β-глобинового локуса и пустынных областей гена (области ENCODE ENm009 и ENr313, соответственно) была создана, как описано (Dekker 2006; Miele et al.2006 г.). Вкратце, набор бактериальных искусственных хромосом (ВАС), покрывающих обе области генома, смешивали, переваривали с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы ВАС из локуса β-глобина и областей пустыни гена были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Следующие семь клонов ВАС использовали для области β-глобина: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов ВАС был выбран для покрытия пустынной области гена 0,5 Mb и включал RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Исследовательского института Детской больницы Окленда (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из EBV-трансформированных B-лимфоцитов и была получена из Coriell Cell Repositories (CCR). Эту клеточную линию культивировали в среде 1640 Roswell Park Memorial Institute (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37 ° C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C выполняли с лог-фазой клеток GM06990 и K562 с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Общую РНК из клеток в логарифмической фазе выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго (dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно оценивали с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические человеческие праймеры β-глобина, использованные в этом анализе, суммированы в дополнительной таблице 1.

Дизайн праймера 5C

Прямой и обратный праймеры были сконструированы для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI.Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления составляла 72 ° C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были сконструированы так, чтобы включать 5′-конец хвоста, который включает (5’– 3 ‘) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированная последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были сконструированы так, чтобы включать 3’-конец хвоста, который включает (5’– 3 ‘) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5C каждый содержали половину сайта рестрикции EcoRI, и только обратные праймеры фосфорилировались на 5’-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотека 3C (представляющая около 150 000 копий генома) или контрольная библиотека (5 нг) была смешана с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ DTT). Образцы денатурировали 5 мин при 95 ° C и отжигали 16 ч при 48 ° C. Отожженные праймеры лигировали в течение 1 ч при 48 ° C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при pH 7,6, 31,25 мМ ацетат калия, 12,5 мМ ацетат магния, 1,25 мМ NAD, 12,5 мМ DTT, 0,125% Triton X -100), содержащий 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65 ° C в течение 10 мин. Продукты лигирования 5C амплифицировали с помощью ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в реакциях ПЦР объемом 25 мкл (32 цикла по 30 секунд денатурирования при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C. ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления не включенных праймеров и других загрязняющих веществ в соответствии с рекомендациями производителя.

Одноплексный и шестиплексный анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~ 150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировались на 35 Циклы ПЦР: 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали с помощью бромистого этидия (0,5 мкг / мл). Sixplex 5C анализ выполняли путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C образцов из шести комплексов детектировали с помощью ПЦР со специфическими внутренними праймерами ПЦР и измеряли на агарозных гелях, как описано выше. ПЦР-детекция продуктов 5C с линейным диапазоном была подтверждена путем двукратного серийного титрования мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микроматрицы библиотеки 5C

Библиотеки 5C были получены путем выполнения множественной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченным праймером обратной ПЦР, комплементарным общей последовательности 3′-конца обратных праймеров 5C (Cy3 -T3modif). Синтез и гибридизация без масок проводились с использованием 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al. 1999; Nuwaysir et al. 2002; Kim et al. 2005; Selzer et al.2005). Каждый массив содержал смысловую цепь предсказанных продуктов лигирования 5C. Матрицы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов с увеличивающейся длиной признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зондов массива (Дополнение). Полное описание конструкции массива доступно по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp.) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Библиотека 5C Анализ высокопроизводительного секвенирования ДНК

Библиотеки 5C были созданы с 73 праймерами 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с 5′-концевыми фосфорилированными праймерами для ПЦР и обрабатывали для пиросеквенирования одной молекулы, как описано ранее (Margulies et al. 2005). Используя платформу GS20, разработанную 454 Life Sciences Corp., было получено 550 189 считываний последовательностей на общую сумму 60 миллионов оснований. Средняя длина чтения составила 108 баз (режим, 112 баз).Каждое считывание анализировали против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество считываний, которые соответствовали каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в β-глобиновом локусе, 72 взаимодействия в области генной пустыни и 451 межобластное взаимодействие. Данные обобщены в дополнительных таблицах 4 и 5.

Массово-параллельное решение для картирования взаимодействий между геномными элементами

Аннотация

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть идентифицированы с помощью хромосомы Методология Conformation Capture (3C).3C преобразует физические взаимодействия хроматина в конкретные продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микроматрицы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения. Мы применили 5C для анализа области 400 т.п.н., содержащей человеческий β-глобиновый локус и консервативную пустынную область гена размером 100 т.п.н. Мы подтвердили 5C путем обнаружения нескольких ранее идентифицированных петлевых взаимодействий в локусе β-глобина.Мы также идентифицировали новое петлевое взаимодействие в клетках K562 между контролирующей областью β-глобинового локуса и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетического переключения генов глобина. 5C должен быть широко применим для крупномасштабного картирования цис — и транс — сетей взаимодействия геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются активные усилия по картированию генов и регуляторных элементов по всему геному человека (ENCODE Project Consortium 2004).Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ только 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http://genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно нанести на карту все гены и функциональные элементы, а также определить все отношения между ними.Например, необходимо идентифицировать все регуляторные элементы каждого гена. Это усилие осложняется тем фактом, что геномные позиции генов и элементов не предоставляют прямой информации о функциональных отношениях между ними. Хорошо известный пример — энхансеры, которые могут регулировать несколько генов-мишеней, которые расположены на больших расстояниях генома или даже на разных хромосомах, не затрагивая гены, расположенные непосредственно рядом с ними (Spilianakis et al. 2005; West and Fraser 2005).

Недавние данные показывают, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямых физических взаимодействиях со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения показывают, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Таким образом, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами можно обнаружить с помощью метода захвата конформации хромосомы (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует сшивание формальдегидом для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Затем взаимодействующие элементы перевариваются рестрикционными ферментами и внутримолекулярно лигируются (). Частота лигирования двух рестрикционных фрагментов является мерой частоты, с которой они взаимодействуют в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотеку 3C генерируют с помощью обычного 3C, а затем преобразуют в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в мультиплексной установке. Затем библиотеки 5C анализируют на микрочипе или путем количественного секвенирования. ( B ) Дизайн праймера 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-конец, содержащий последовательность промотора Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину рестрикционного сайта. Все обратные праймеры содержат общий 3′-конец с комплементарной последовательностью Т3 (T3c) и фосфорилируются на 5′-конце. Прямой и обратный праймеры 5C отжигаются с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации дрожжевой хромосомы III (Dekker et al. 2002) и с тех пор применялся для анализа нескольких локусов млекопитающих, таких как β-глобиновый локус (Tolhuis et al.2002; Palstra et al. 2003; Vakoc et al. 2005), локус цитокинов Т-хелперов типа 2 (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом петля ДНК выходит наружу. 3C также использовался для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально связанными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005; Ling et al. 2006; Xu et al. 2006 г.). Вместе эти исследования предполагают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для обнаружения индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микроматрицы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует высоко мультиплексную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или путем количественного секвенирования ДНК.

5C был разработан и утвержден путем анализа человеческого β-глобинового локуса и консервативной области пустыни гена, расположенной на хромосоме человека 16. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий петель ДНК. Интересно, что анализ 5C также идентифицировал петлевое взаимодействие между β-globin Locus Control Region (LCR) и γ-δ межгенным регионом. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в клетках плода на экспрессию β-глобина во взрослых клетках (Calzolari et al.1999; Грибнау и др. 2000).

5C должен быть широко применим для определения связности цис и транс регуляторных элементов во всех крупных геномных областях. Кроме того, эксперименты 5C могут быть спроектированы таким образом, чтобы можно было создать полные карты взаимодействия для любой большой интересующей области генома, которые могут выявить местоположения новых регуляторных элементов генов, а также могут предоставить подробные сведения о сворачивании хромосом более высокого порядка.

Результаты

Метод 3C был подробно описан (Dekker et al.2002; Splinter et al. 2004; Vakoc et al. 2005; Dekker 2006; Miele et al. 2006) и проиллюстрирован в. Эксперимент 3C генерирует сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие по всему геному. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C частоты индивидуальных взаимодействий определяют путем количественной оценки образования предсказанных продуктов лигирования «голова к голове» с помощью полуколичественной ПЦР ().В качестве контроля ПЦР используется библиотека, содержащая все продукты лигирования в эквимолярных количествах. Контрольную библиотеку получают путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.

Краткое описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al. 1988; Li et al. 2005; Peck et al. 2006). Можно лигировать только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы на основе LMA являются количественными и могут выполняться на высоких уровнях мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al.2004; Бибикова и др. 2005; Hardenbol et al. 2005; Wang et al. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают на библиотеке 3C и лигируют. Используют два типа праймеров 5C: прямые 5C и обратные праймеры 5C. Эти праймеры сконструированы таким образом, что прямой и обратный праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (). Праймеры 5C, которые отжигаются рядом друг с другом, затем лигируют Taq-лигазой.На этом этапе создается библиотека 5C, которая амплифицируется с универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируют только тогда, когда оба отжигаются с конкретным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C образуются и как часто. В результате библиотека 5C представляет собой количественную «точную копию» части библиотеки 3C, как определено с помощью коллекции праймеров 5C.

Прямой и обратный праймеры 5C разработаны так, чтобы содержать уникальную последовательность, соответствующую смысловой и антисмысловой цепи 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. В дополнительном материале).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Для анализа взаимодействий между множеством рестрикционных фрагментов несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, только один праймер на каждый фрагмент, прямой или обратный, можно использовать в данном эксперименте 5С. Для облегчения лигирования все обратные праймеры фосфорилируются на своих 5′-концах.Эта конструкция праймера 5C позволяет одновременную амплификацию всех потенциальных взаимодействий между всеми фрагментами рестрикции, распознаваемыми прямым праймером, и всеми фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в человеческом β-глобиновом локусе

Мы разработали и оптимизировали подход 5C, проанализировав человеческий β-глобиновый локус. Этот локус был выбран потому, что несколько петлевых взаимодействий были ранее обнаружены 3C, а также вторым методом, RNA-TRAP (Carter et al.2002; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с использованием 5C можно использовать для проверки нового метода.

Человеческий β-глобиновый локус состоит из пяти онтогенетически регулируемых β-глобиноподобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, HBB . ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную перед кластером генов (). LCR характеризуется пятью сайтами гиперчувствительности к DNaseI (HS1-5) и необходим для тканеспецифической и независимой от положения экспрессии нижележащих β-глобиновых генов (Li et al.2002; Стаматояннопулос 2005). Предыдущий 3C анализ мышиного β-глобинового локуса выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). LCR, как было обнаружено, взаимодействует с элементами HS, расположенными выше (HS-62.5 / HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ человеческого β-глобинового локуса и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положение ГС обозначено черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»: «entrez-нуклеотид», «attrs»: {«text»: «BU661736», «term_id»: «23373918», «term_text»: «BU661736»} } BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью β-глобинового локуса.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось y указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение по крайней мере трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (S.E.M.). ( C ) Типичное титрование библиотеки 3C в одноплексном LMA с праймерами 5C. Возрастающие объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров гена пустыни 5C, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют собой S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено на 1. Каждое значение гистограммы представляет собой среднее значение по крайней мере трех ПЦР; полосы представляют собой S.E.M.

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя стандартный метод 3C. Локус анализировали в линии клеток эритролейкемии К562 и в линии лимфобластоидных клеток, трансформированных EBV, GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (Дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов ВАС (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и рестрикционными фрагментами EcoRI по всему β-глобиновому локусу определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействий, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, консервативной пустынной области гена на хромосоме 16 (область ENCODE ENr313) (Консорциум проектов ENCODE 2004 г.).

Нормализованные результаты представлены в. В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие из внутренней непосредственной близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлевых взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006 г.). Важно отметить, что случайные коллизии, по прогнозам, будут постепенно уменьшаться для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 высокие частоты взаимодействия наблюдались, в частности, между LCR и рестрикционным фрагментом, расположенным на ∼40 kb ниже и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения в субядерной локализации.

На основании этого анализа мы пришли к выводу, что конформация человеческого β-глобинового локуса сравнима с мышиным локусом с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в экспрессирующих глобин клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямого и обратного праймеров 5C, чтобы убедиться, что этот метод может количественно детектировать продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5C, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA выполняли с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (созданной из клеток K562), и образование лигированных прямого и обратного праймеров количественно оценивали с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается при наличии неспецифической ДНК, зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

Обнаружение LMA петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одноплексный LMA для количественного определения взаимодействий петель хроматина в β-глобиновом локусе. Мы сосредоточились на взаимодействиях с участием LCR и трех диагностических фрагментов в β-глобиновом локусе (обозначенных полосами): рестрикционного фрагмента, расположенного сразу после LCR, рестрикционного фрагмента, который перекрывает ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между генами δ- и β-глобина.Мы разработали обратный праймер 5C для рестрикционного фрагмента, перекрывающий HS5 LCR, и прямой 5C праймер для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с отдельными парами праймеров 5C в присутствии возрастающих количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнительная).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем расчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с помощью контрольной библиотеки.Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы обнаружили, что данные, полученные с помощью LMA, близко воспроизводят данные 3C, включая петлевое взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изученные здесь частоты взаимодействия (три в β-глобиновом локусе и одна в контрольной области) быть обнаружены и количественно определены в мультиплексной LMA-реакции.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы вычислили нормализованные частоты взаимодействия, как описано выше. Мы снова получили те же результаты, что и с обычным 3C (, правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием высоко мультиплексированного LMA

Для всестороннего 5C-анализа взаимодействий хроматина в крупных геномных областях потребуются высокие уровни мультиплексирования в сочетании с высокопроизводительным методом анализа 5C-библиотек.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и исследовали два высокопроизводительных метода обнаружения для анализа библиотек 5C: микроматрицы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех рестрикционных фрагментов EcoRI, которые перекрывают LCR, и прямые праймеры 5C для 55 рестрикционных фрагментов в области 400 т.п.н. вокруг LCR. Этот дизайн праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. Ниже).Мы также сконструировали 10 прямых праймеров 5C и 10 обратных праймеров 5C по всей области размером 100 т.п.н. в контрольной области генной пустыни. Прямой и обратный праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема конструирования праймеров позволяет обнаруживать матрицу взаимодействий по всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве шаблонов. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри β-глобинового локуса, 100 взаимодействий по всей генной пустыне и 590 взаимодействий между двумя геномными областями. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в. Мы использовали специфические праймеры для ПЦР для количественной оценки количества конкретных продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше.Мы обнаружили, что данные 5C близко воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнительная) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C повторяет профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина HS5 локуса β-глобина человека в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микроматрицы. Ось y указывает нормированные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а полосы ошибок представляют собой S.E.M. Схематическое изображение всего локуса представлено на вершине . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Планки погрешностей указывают стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчетов. Стандартные отклонения были распространены с использованием дельта-метода. ( D ) Корреляция между профилями 3C и 5C человеческих β-глобиновых локусов из клеток K562. Результаты 5C микроматрицы и секвенирования ДНК сравнивали с соответствующими данными 3C путем вычисления кратной разницы (логарифмическое соотношение 5C / 3C) для каждой пары взаимодействующих фрагментов (х-ось). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и путем количественного секвенирования

Мы проверили, можно ли использовать обнаружение микроматриц и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микроматрицы, мы амплифицировали библиотеки 5C, описанные выше, с универсальными праймерами, меченными Cy3.Помеченные библиотеки 5C затем гибридизовали с специально разработанным микрочипом, который может обнаруживать конкретные продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, которые разделяют один полусайт. Для оценки кросс-гибридизации на полусайтах микроматрица также содержала зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микроматрицы, которая допускает наименьшую перекрестную гибридизацию, на каждый зонд наносили пятно с 18 полусайтами различной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C были гибридизованы с массивом, и была определена специфическая гибридизация и гибридизация половинного сайта. Мы обнаружили, что зонды, которые состоят из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень перекрестной гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, и частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с помощью библиотеки 5C, на сигнал, полученный с помощью контрольной библиотеки (см. Ниже; дополнительную таблицу 7).

Крупномасштабный 5C-анализ человеческого β-глобинового локуса. ( A ) Положения прямого (, верхний, ) и обратный (, нижний, ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью 5C и микрочипов ( верхний ), 3C ( средний ) и 5C и анализа количественного секвенирования ( нижний ).Β-глобиновый локус, проиллюстрированный выше профилей, включает в себя особенности, описанные в. Направленная вперед стрелка указывает местоположение альтернативного сайта начала транскрипции ε-глобина. Светло-оранжевые и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелки указывают HS, идентифицированные в клетках K562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагалось, являются ортологами HS-62.5 / -62.0 в локусе мышей (Farrell et al.2002; Bulger et al. 2003). ( C ) Профиль взаимодействия хроматина HS2 / 3/4 LCR с областью 400 т.п.н. вокруг LCR, как определено с помощью микроматрицы ( вверху ) и количественного секвенирования ( внизу ). Цветные вертикальные полосы подчеркивают взаимодействия между LCR и вышележащими HSs и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C путем количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК, каждая из которых имеет длину ~ 100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул.Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микроматрицы, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки с помощью платформы GS20, разработанной 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160000 считываний последовательностей (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали количество раз, когда каждый конкретный продукт лигирования 5C был секвенирован (см. Методы; дополнительная таблица 5).Поскольку каждый продукт лигирования был секвенирован много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз секвенирования продукта 5C в библиотеке 5C на количество раз, которое он секвенировал в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ β-глобинового локуса

Сначала мы проанализировали профили взаимодействия HS5 по всему β-глобиновому локусу размером 100 т.п.н., обнаруженные на микрочипе () и с помощью количественного секвенирования ().Для сравнения, тот же профиль взаимодействия был также определен стандартным 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микроматрицы, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C β-глобинового локуса в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлевое взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-глобина, который слабо экспрессируется в клетках K562, но молчит в GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы сравнили наборы данных 5C и 3C напрямую, вычислив для каждой пары взаимодействующих фрагментов кратную разницу между их частотами взаимодействия, определенную с помощью 5C и 3C.Мы обнаружили, что разница в данных 5C, полученных с помощью обнаружения микроматрицы и обычного 3C, обычно меньше двух раз (). Однако большие различия наблюдались при сравнении данных 5C, полученных путем количественного секвенирования, с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном путем секвенирования, по сравнению с полуколичественным ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на диаграмму рассеяния (Дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием, и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации гена пустынной контрольной области. ( A ) Положения чередующихся 5C прямого ( верхний ) и обратный ( нижний ) праймеров по всей контрольной области генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( левая панель ), 5C и микрочипов ( средняя панель ), а также 5C и количественного секвенирования ( правая панель ). Частоты взаимодействия представлены в зависимости от геномного расстояния между взаимодействующими фрагментами. Полоски представляют собой S.E.M. Частоты взаимодействия, обнаруженные в ячейках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание: праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с этими праймерами, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

Взятые вместе, эти результаты обеспечивают четкое доказательство принципа того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой производительности. .

Взаимодействия между HS5 и вышележащими элементами

LCR мыши взаимодействует с HS элементами (HS-62.5 / HS-60), расположенными на расстоянии до 40 kb выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли функционально эквивалентные взаимодействующие элементы в этой области генома человека. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.н. выше LCR, ортологичны генам, расположенным на 40 т.п.н. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области связаны.Кроме того, мышиный элемент HS-62.5 / HS-60 встроен в последовательность, аналогичную последовательности, расположенной на 90 т.п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная на ~ 90 т.п.н. выше LCR человека, является ортологичной области, расположенной на ~ 40 т.п.н. выше локуса мыши, предполагая, что эта область может также взаимодействовать с LCR в человеческих клетках. Чтобы объективно оценить, взаимодействует ли LCR с какими-либо вышестоящими элементами в локусе человека, описанный выше эксперимент 5C был разработан, чтобы включить анализ большой области, расположенной перед LCR.

Мы проанализировали профили взаимодействия, полученные с помощью обнаружения на микрочипах и количественного секвенирования HS5 с областью до 280 т.п.н. перед LCR. Оба набора данных показали, что взаимодействия во всей этой области обычно намного ниже, чем наблюдаемые между LCR и β-глобиновым локусом. Однако в обеих клеточных линиях мы действительно обнаружили повышенные частоты взаимодействия во всем большом домене, расположенном на 50–100 kb выше LCR (). Этот результат был подтвержден традиционным анализом 3C (см.верхняя, средняя и нижняя панели). Эта область содержит три гена обонятельных рецепторов и множество сайтов HS (Bulger et al. 2003).

Эти результаты предполагают, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в локусе мыши. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местоположения новых предполагаемых регуляторных элементов.

Параллельный анализ множественных профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между множественными интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, прямой и обратный праймеры 5C были разработаны для одновременного обнаружения профилей взаимодействия каждой из трех субсекций LCR с 400 т.п.н. окружающего хроматина.Данные, полученные с помощью микроматричного анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2 / 3/4 фрагмента LCR, очень похож на профиль HS5 (). Интересно, что мы обнаружили, что в клетках K562 HS2 / 3/4 чаще взаимодействует с сайтами по всему β-глобиновому локусу, чем HS5, подтверждая, что эти HSs могут вносить наибольший вклад в формирование петель хроматина с LCR. Анализ 5C 3′-конца LCR, который содержит HS1, не дал достаточных уровней продуктов лигирования для получения значительного числа считываний последовательности.Анализ сигналов гибридизации микроматрицы подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали паттернам, полученным для HS5 и HS2 / 3/4 (дополнительная таблица 7 ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ β-глобинового локуса был сфокусирован на картировании взаимодействий между фиксированным регуляторным элементом, LCR и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов определены плохо. Здесь мы приводим пример альтернативной схемы конструирования праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Описанный выше 5C-анализ включал 10 прямых и 10 обратных 5C-праймеров для рестрикционных фрагментов, расположенных в контрольной области генной пустыни (). Важно отметить, что прямой и обратный праймеры были разработаны для чередования рестрикционных фрагментов ().В совокупности эти праймеры выявляли взаимодействия хроматина во всем регионе. Частоты взаимодействия, определенные с помощью анализа микрочипов и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействия снижается с увеличением геномного расстояния (). Аналогичные результаты были получены с помощью обычного анализа 3C.

Графики не показывают, где вдоль хромосомы были измерены определенные частоты взаимодействия.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямым и обратным праймерами 5C в виде двумерных тепловых карт, на которых цвет каждого квадрата является показателем частоты взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этой генной пустынной области, очень отличается от наблюдаемого в β-глобиновом локусе и согласуется с поведением хаотической спирали хроматинового волокна без дальнодействующих петлевых взаимодействий (Rippe 2001; Dekker et al.2002; Деккер 2006).

Обсуждение

Разработка 3C значительно облегчила обнаружение и изучение взаимодействий цис и транс между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить диапазон приложений 3C, позволяя комплексное и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа β-глобинового локуса

Мы проверили 5C путем обнаружения взаимодействий петель хроматина в человеческом β-глобиновом локусе. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессируемыми генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в GM06990, LCR также взаимодействует с 3′-HS1 элементом и большим доменом, расположенным на 50–100 kb выше. Последняя область соответствует области вокруг HS-62.5 / HS-60 в локусе мышей (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HSs была предложена для создания хроматинового концентратора или специализированного ядерного компартмента, предназначенного для транскрипции β-глобиновых генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые HS в β-глобиновом локусе связывают инсулятор-связывающий белок CTCF (Farrell et al., 2002; Bulger et al., 2003) (а для HS5 человека см. Дополнительный рис.6), и было предложено, что этот белок опосредует их взаимодействия и образование хаба хроматина (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых из элементов не влияет напрямую на экспрессию β-глобина (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они не могут напрямую регулировать экспрессию β-глобина, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2 / 3/4 очень похожи, за исключением того, что HS2 / 3/4 чаще взаимодействует с β-глобиновым локусом, особенно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al. 1993; Peterson et al. 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген глобина наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое взаимодействие петель хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что этот регион участвует в контроле развития β-глобинового локуса (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнительная информация), что позволяет предположить, что петлевое взаимодействие может участвовать в активации транскрипции. Эта область также содержит промотор для большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-глобина (Gribnau et al. 2000).Некоторые пациенты, которые страдают от наследственной персистенции гемоглобина плода, несут делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al. 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными областями γ – δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенной области, несмотря на присутствие несколько слабых предполагаемых сайтов связывания CTCF (дополнительный рис. 6).

Обнаружение микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования микроматриц, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также заметили несколько отличий. Во-первых, динамический диапазон обнаружения микроматрицы был меньше, чем у количественного секвенирования, как наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученными с помощью микроматричного анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ – δ (рис.). Эти различия могут отражать внутренние предубеждения в методах обнаружения, но также могут быть связаны с экспериментальными вариациями между независимо созданными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает больший динамический диапазон и устраняет необходимость в создании определенного массива для каждой интересующей области генома. С другой стороны, микроматричный анализ в настоящее время более рентабелен, особенно когда конкретная область генома должна быть проанализирована в большом количестве различных условий.

Данные 5C, полученные путем секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно определили 451 взаимодействие между β-глобиновым локусом и пустынной областью контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-глобина и область генной пустыни должны преимущественно взаимодействовать. Поэтому мы предположили, что эти частоты межхромосомного взаимодействия будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие частоты фонового взаимодействия между двумя регионами (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2 / 3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймеров или экспериментальный шум. Будущие крупномасштабные анализы 5C предоставят более подробное представление об этих проблемах.

Приложения 5C

5C полагается на мультиплексную амплификацию, опосредованную лигированием, и, таким образом, потенциально ограничивается количеством праймеров 5C, которые могут использоваться в одной реакции.В других анализах, основанных на LMA, в одной реакции успешно использовались многие тысячи праймеров. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси ∼6000 праймеров (Бибикова и др., 2005). Другим примером является использование высоко мультиплексированных LMA с до 20 000 зондов молекулярной инверсии в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10000 праймеров 5C в одном эксперименте, до 25 миллионов различных взаимодействий хроматина могут быть обнаружены параллельно с участием до 40 МБ (10000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для высоко мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые были использованы для создания проанализированных здесь библиотек 5C, прекрасно распознали многочисленные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы ожидаем два типа приложений 5C, которые различаются схемами разработки праймеров 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными интересующими элементами генома, подобно анализу локуса β-глобина, описанному здесь.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис или в транс , чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов, параллельно в одной реакции, с последующим анализом на специально разработанной микроматрице или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого интересующего фиксированного фрагмента, а прямые праймеры 5C конструируют для всех других рестрикционных фрагментов, как показано на.Этот тип анализа позволит быстро обнаруживать сети взаимодействий между множеством генов и регуляторных элементов в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействий, которые охватывают большую часть или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямой и обратный праймеры 5C разработаны для чередования рестрикционных фрагментов, как это выполнено здесь для контрольной области генной пустыни (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой 5C-анализ не предоставит полную карту взаимодействий для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются прямыми праймерами или обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с перестановкой схемы конструирования праймеров 5C для получения частично перекрывающихся матриц взаимодействий. В сочетании эти карты могут дать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будут соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействий может использоваться в качестве инструмента открытия для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействий может также предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Селекция ВАС и подготовка контрольной библиотеки

Контрольная библиотека для человеческого β-глобинового локуса и пустынных областей гена (области ENCODE ENm009 и ENr313, соответственно) была создана, как описано (Dekker 2006; Miele et al.2006 г.). Вкратце, набор бактериальных искусственных хромосом (ВАС), покрывающих обе области генома, смешивали, переваривали с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы ВАС из локуса β-глобина и областей пустыни гена были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Следующие семь клонов ВАС использовали для области β-глобина: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов ВАС был выбран для покрытия пустынной области гена 0,5 Mb и включал RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Исследовательского института Детской больницы Окленда (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из EBV-трансформированных B-лимфоцитов и была получена из Coriell Cell Repositories (CCR). Эту клеточную линию культивировали в среде 1640 Roswell Park Memorial Institute (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37 ° C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C выполняли с лог-фазой клеток GM06990 и K562 с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Общую РНК из клеток в логарифмической фазе выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго (dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно оценивали с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические человеческие праймеры β-глобина, использованные в этом анализе, суммированы в дополнительной таблице 1.

Дизайн праймера 5C

Прямой и обратный праймеры были сконструированы для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI.Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления составляла 72 ° C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были сконструированы так, чтобы включать 5′-конец хвоста, который включает (5’– 3 ‘) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированная последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были сконструированы так, чтобы включать 3’-конец хвоста, который включает (5’– 3 ‘) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5C каждый содержали половину сайта рестрикции EcoRI, и только обратные праймеры фосфорилировались на 5’-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотека 3C (представляющая около 150 000 копий генома) или контрольная библиотека (5 нг) была смешана с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ DTT). Образцы денатурировали 5 мин при 95 ° C и отжигали 16 ч при 48 ° C. Отожженные праймеры лигировали в течение 1 ч при 48 ° C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при pH 7,6, 31,25 мМ ацетат калия, 12,5 мМ ацетат магния, 1,25 мМ NAD, 12,5 мМ DTT, 0,125% Triton X -100), содержащий 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65 ° C в течение 10 мин. Продукты лигирования 5C амплифицировали с помощью ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в реакциях ПЦР объемом 25 мкл (32 цикла по 30 секунд денатурирования при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C. ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления не включенных праймеров и других загрязняющих веществ в соответствии с рекомендациями производителя.

Одноплексный и шестиплексный анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~ 150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировались на 35 Циклы ПЦР: 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 30 секунд удлинения при 72 ° C.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали с помощью бромистого этидия (0,5 мкг / мл). Sixplex 5C анализ выполняли путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C образцов из шести комплексов детектировали с помощью ПЦР со специфическими внутренними праймерами ПЦР и измеряли на агарозных гелях, как описано выше. ПЦР-детекция продуктов 5C с линейным диапазоном была подтверждена путем двукратного серийного титрования мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микроматрицы библиотеки 5C

Библиотеки 5C были получены путем выполнения множественной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченным праймером обратной ПЦР, комплементарным общей последовательности 3′-конца обратных праймеров 5C (Cy3 -T3modif). Синтез и гибридизация без масок проводились с использованием 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al. 1999; Nuwaysir et al. 2002; Kim et al. 2005; Selzer et al.2005). Каждый массив содержал смысловую цепь предсказанных продуктов лигирования 5C. Матрицы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов с увеличивающейся длиной признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зондов массива (Дополнение). Полное описание конструкции массива доступно по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp.) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Библиотека 5C Анализ высокопроизводительного секвенирования ДНК

Библиотеки 5C были созданы с 73 праймерами 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с 5′-концевыми фосфорилированными праймерами для ПЦР и обрабатывали для пиросеквенирования одной молекулы, как описано ранее (Margulies et al. 2005). Используя платформу GS20, разработанную 454 Life Sciences Corp., было получено 550 189 считываний последовательностей на общую сумму 60 миллионов оснований. Средняя длина чтения составила 108 баз (режим, 112 баз).Каждое считывание анализировали против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество считываний, которые соответствовали каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в β-глобиновом локусе, 72 взаимодействия в области генной пустыни и 451 межобластное взаимодействие. Данные обобщены в дополнительных таблицах 4 и 5.

Углеродная копия хромосомной конформации (5C)

Вы уже получили суточную дозу витамина С? На всякий случай вот еще пять.5C полезен для детального изучения взаимодействий с конкретными интересующими локусами. 5C использует специальные праймеры, которые отжигаются через лигированные соединения фрагментов ДНК. Хвосты праймеров содержат универсальную последовательность, которая позволяет амплифицировать все продукты лигирования. Эта библиотека копий характеризуется использованием микрочипов или секвенирования.

Основным преимуществом 5C перед 4C и 3C является его крупномасштабное мультиплексирование, которое позволяет создавать более крупномасштабную матрицу взаимодействия, обеспечивая более точные 3D-реконструкции (Dekker et al., 2013). Однако 5C не заменяет 4C. Во-первых, не все сайты позволяют создавать праймеры 5C, а это означает, что 4C может иметь более высокое разрешение. Кроме того, 5C требует, чтобы каждый праймер был разработан, а это означает, что невозможно исследовать весь геном, поскольку потребуются миллионы праймеров. 5C был представлен в 2007 году (Dostie and Dekker, 2007). С тех пор его использовали для понимания многих процессов, включая роль ncRNAs в регуляции Hox генов (Wang et al., 2011). 5C недавно был объединен с Hi-C, чтобы раскрыть организацию хромосом во время митоза (Наумова и др., 2013)

Дополнительную информацию о методах захвата конформации хромосом можно найти в этой статье о Hi-C и связанных методах от наших друзей из Active Motif.

5C Дополнительное чтение

Саньял, А., Ладжуа, Б.Р., Джайн, Г., и Деккер, Дж. (2012). Пейзаж дальнего взаимодействия промоторов генов. Природа 489, 109-113.

В этой статье 5C применяется для понимания крупномасштабных петлевых взаимодействий в геноме человека. Авторы также объединяют данные проекта ENCODE, чтобы показать, как эпигенетические метки влияют на образование петель хромосом.

Умбаргер, М.А. (2012). Анализы захвата конформации хромосом у бактерий. Методы 58, 212-220.

Предполагается, что организация бактериальных хромосом случайна. Последние данные 5C опровергают это предположение. В этом обзоре представлены результаты экспериментов с 5С на бактериях, которые показывают, что хромосома действительно высокоорганизована.

Справочный лист

  • Деккер, Дж., Марти-Реном, М.А., и Мирный, Л.А. (2013).Изучение трехмерной организации геномов: интерпретация данных взаимодействия хроматина. Nat. Преподобный Жене. 14, 390-403.
  • Дости Дж. И Деккер Дж. (2007). Картирование сетей физических взаимодействий между геномными элементами с использованием технологии 5C. Nat. Protoc. 2, 988-1002.
  • Наумова Н., Имакаев М., Фуденберг Г., Жан Ю., Ладжуа Б. Р., Мирный Л. А., Деккер Дж. (2013). Организация митотической хромосомы. Наука 342, 948-953.
  • Ван, К.С., Ян, Ю.В., Лю, Б., Саньял, А., Корсес-Циммерман, Р., Чен, Ю., Ладжой, Б.Р., Протасио, А., Флинн, Р.А., Гупта, Р.А. и др. (2011). Длинная некодирующая РНК поддерживает активный хроматин для координации экспрессии гомеотических генов. Природа 472, 120-124.

5 принципов маркетинга

5 принципов маркетинга — это широко используемый метод ситуационного анализа, который помогает маркетологам принимать обоснованные бизнес-решения. Знак «5 C» означает компанию, клиентов, конкурентов, сотрудников и климат.Короче говоря, анализ 5c поможет вам оценить наиболее важные факторы, с которыми сталкивается ваш бизнес. Это похоже на проверку работоспособности вашего бизнеса — сосредоточив внимание на наиболее важных частях вашего бизнеса и определив, что работает хорошо, а что нет, вы сможете принимать более информированные и более прибыльные решения.

Анализ 5c является одной из самых популярных моделей ситуационного анализа благодаря своей эффективности и простоте и является отличным выбором для малого и среднего бизнеса.Мы рекомендуем вам проводить анализ 5c не реже одного раза в год — это не займет много времени и поможет вам всегда быть в курсе самых крупных и важных факторов, влияющих на ваш бизнес.

Анализ 5c — одна из семейства моделей ситуационного анализа. Есть несколько способов провести анализ маркетинговой ситуации — возможно, вы знакомы с базовой, но эффективной моделью SWOT (сильные и слабые стороны, возможности, угрозы). Сегодня мы рассмотрим еще одну стратегию ситуационного анализа, которая немного глубже, чем модель SWOT, — 5 C’s Marketing .Мы разберем, что влечет за собой эта модель, как ее использовать для вашего собственного онлайн-бизнеса, и рассмотрим пример анализа 5c.

Модель маркетингового анализа 5c

Как следует из названия, модель 5c фокусируется на 5 ключевых буквах «C». Каждый C представляет собой основной элемент, связанный с вашей общей бизнес-моделью.

5с маркетинга

  1. Компания
  2. соавторы
  3. Клиенты
  4. Конкуренты
  5. Климат

Оценив эти аспекты вашего бизнеса, вы получите хорошее общее представление о своем бизнесе.Когда придет время принимать решения о маркетинге, у вас будет шпаргалка, которая поможет вам принимать более правильные решения.


Как провести анализ 5c — вопросы, которые нужно задать

Компания

Начните с вопросов, связанных с вашим бизнесом:

  1. Что продает моя компания? Перечислите ваши основные производственные линии или типы.
  2. Отличаются ли наши продукты от продуктов конкурентов? Если так, то каким образом?
  3. Какое конкурентное преимущество есть у моей компании?
  4. Что делает мой бренд уникальным или запоминающимся?
  5. Чем моя компания работает лучше других?
  6. Чем мой бизнес хуже других?
  7. Как клиенты видят мой бизнес?
  8. Если бы я внезапно получил 10 000 долларов для инвестирования в свой бизнес, куда бы я их вложил?
  9. Если бы мне вдруг пришлось сократить свой бюджет на 10%, где бы я сделал это сокращение?
  10. Каковы мои цели на 1, 3 и 5 лет для этой компании?

Если вам сложно ответить на некоторые из этих вопросов, подумайте о том, чтобы начать с более простого SWOT-анализа.Хотя в целом она не так полезна, как модель 5c, она может стать хорошей отправной точкой, которая поможет вам лучше понять свою компанию.

Также очень важно быть откровенным и честным во время этого процесса, особенно в отношении своих слабостей и того, где ваши конкуренты опережают вас. После того, как вы ответите на эти вопросы, потратьте немного времени и спросите себя, какие чувства вызывают у вас ответы на эти вопросы. Есть ли такие места, на которые вы бы хотели ответить по-другому? Если да, запишите, каким был бы ваш идеальный ответ — это отличный способ поставить как краткосрочные, так и долгосрочные цели для вашей компании.

Соавторы

В этом разделе перечислите любое лицо или службу, с которыми работает ваша компания. Думайте об этом как о справочнике или телефонной книге для вашей компании — например, когда поставщик опаздывает с заказом, вы можете обратиться к списку соавторов, чтобы быстро выяснить, кому вам нужно позвонить, чтобы исправить это. Для каждого соавтора запишите основное контактное лицо, его адрес электронной почты, номер телефона и другую важную информацию.

Вот несколько вопросов, которые можно задать, и примеры сотрудников, с которыми компании работают чаще всего:

  1. Кто управляет повседневной деятельностью компании?
  2. Есть ли у меня партнер, который помогает управлять компанией?
  3. Есть ли у меня инвесторы или заинтересованные стороны?
  4. Кто создает или поставляет продукты, которые я продаю?
  5. Кто мой поставщик услуг доставки?
  6. Кто обрабатывает платежи по моей кредитной карте?
  7. Кто предоставляет мою платформу электронной коммерции?
  8. Кто занимается моими запасами или складскими операциями?
  9. У кого я зарегистрировал свой домен?
  10. Кто-нибудь помогает мне создать мой сайт?
  11. Есть ли у меня кто-нибудь, кто пишет для меня описания продуктов, статьи или другие копии?
  12. Кто-нибудь помогает мне с маркетингом или рекламой?
  13. Работаю ли я с фотографом на постоянной основе?
  14. Есть ли у меня кто-нибудь, кто распространяет или продает мои продукты для меня?
  15. Есть ли у меня кто-нибудь, у кого есть мои учетные записи в социальных сетях?
  16. Работаю ли я с фрилансерами или подрядчиками?
  17. Есть ли еще кто-нибудь, с кем я работаю на регулярной основе?

Заполнив раздел соавторов, вы, вероятно, поймете, что для ведения вашего бизнеса требуется больше людей (или услуг), чем вы первоначально предполагали.Указание здесь всех ваших соавторов поможет вам отслеживать, кто за что отвечает. Это также дает вам место для начала, когда вы хотите сделать свой бизнес более продуктивным или эффективным — вы можете понять, что у вас есть подрядчик в платежной ведомости, который не отправлял вам электронные письма в течение нескольких месяцев.

Клиенты

Одна из самых важных составляющих любого бизнеса — это клиенты, которые покупают ваши продукты. Получив четкое представление о том, кто ваши клиенты, чего они хотят и насколько ваш продукт соответствует их потребностям, вы сможете гораздо эффективнее доставлять продукты, которые ваши клиенты хотят покупать (и продолжают покупать).Вы также будете лучше подготовлены, когда дело доходит до ваших маркетинговых усилий — вы не только будете продвигать свои продукты для нужной аудитории, вы также будете знать, какой язык и образы находят отклик у ваших потенциальных клиентов. Наконец, анализ клиентов — один из лучших способов узнать о ваших продуктах и ​​бизнесе: выяснив, что клиентам нравится и что не нравится в ваших продуктах и ​​бизнесе, вы получите представление о том, что для вас важнее всего. Начните анализ клиентов, задав следующие вопросы.Если вы ориентируетесь на несколько сегментов рынка, вы можете ответить на эти вопросы для каждого сегмента:

  1. Как выглядят идеальные покупатели моих товаров?
  2. Кто моя целевая аудитория?
  3. Кто в настоящее время покупает мои продукты?
  4. Какие виды товаров продаются чаще / реже всего?
  5. Какие из моих продуктов имеют очень хорошие отзывы? Плохие отзывы? Нет отзывов?
  6. Как мои клиенты ведут себя на моем веб-сайте? Какие страницы они посещают чаще всего?
  7. Как мои клиенты находят мой сайт или продукты?
  8. Моя аудитория в целом растет или сокращается?
  9. Сколько повторных покупок делают мои клиенты? Насколько важны повторные покупки для моей бизнес-модели?
  10. Какие рекламные акции или кампании были наиболее эффективными для увеличения продаж в прошлом?
  11. Есть ли сезонность или тенденции в покупках клиентов?
  12. Проводят ли покупатели тщательное исследование перед покупкой или покупают импульсивно?
  13. Что побуждает моих клиентов покупать? (Цена, качество, удобство, уникальность продукта и т. Д.)
  14. Куда мой клиент может получить дополнительную информацию о моих продуктах?
  15. Каковы мои каналы связи с моими клиентами?
  16. Какие источники отзывов клиентов у меня есть?
  17. Какая проблема или жалоба клиентов наиболее частая?
  18. Какая самая распространенная похвала или положительный отзыв?
  19. Какие вещи наиболее интересны моим клиентам? Наименее интересно?
  20. Если бы я мог рассказать своим клиентам только одно о моем бизнесе, что бы это было?

Цель этих вопросов — понять ваших клиентов, их поведение и лежащие в их основе мотивации.Если у вас возникли трудности с этим разделом, вы не одиноки — самая сложная и важная часть маркетинга — это по-настоящему понять клиента. Если вы разгадываете эту головоломку, вы получаете конкурентное преимущество, которое конкурентам будет сложно превзойти. Используйте все имеющиеся в вашем распоряжении источники отзывов клиентов, чтобы помочь вам сформировать ответы на эти вопросы, и обязательно пересматривайте свой анализ клиентов по мере того, как вы узнаете о них больше или по мере изменения вашей целевой аудитории.

Конкуренты

Понимание конкурентов так же важно, как и понимание собственного бизнеса.Ознакомьтесь с нашим руководством по анализу конкурентов для электронной торговли, а затем ответьте на следующие вопросы о своих конкурентах:

  1. Кто ваши прямые конкуренты?
  2. Какие мои постоянные конкуренты? Какие конкуренты новые или появляющиеся?
  3. Что предлагают мои конкуренты, чего я не могу?
  4. Каковы самые сильные стороны каждого из моих конкурентов?
  5. Каковы самые большие недостатки моих конкурентов? (Подсказка — проверьте отзывы о продукте и компании)
  6. Какие стратегии используют мои конкуренты для привлечения клиентов?
  7. Есть ли что-то из того, что делают мои конкуренты, чего я не могу?
  8. Есть ли что-то, что может сделать мой бизнес, чего не могут мои конкуренты?
  9. На какую аудиторию ориентируются мои конкуренты?
  10. Какой контент создает каждый конкурент?
  11. Какие виды присутствия в социальных сетях есть у каждого конкурента?

Знание общей рыночной позиции, сильных и слабых сторон вашего конкурента даст вам огромное преимущество — в конце концов, вы не сможете эффективно конкурировать, если не знаете, кто ваши настоящие противники.Вероятно, вы захотите сосредоточиться на компаниях, аналогичных по размеру вашей собственной, но ничего страшного, если ваши конкуренты крупнее или более устоявшиеся, чем вы — хотя поначалу может показаться, что это не так, небольшие компании имеют ряд преимуществ перед более крупными. компании. Поскольку они не управляются комитетом и не связаны с заинтересованными сторонами, небольшие компании могут быть гораздо более гибкими и изобретательными в своем маркетинге, что может с лихвой компенсировать гигантский рекламный бюджет. Как говорит Сунь-Цзы: «Если вы знаете врага и знаете себя, вам не нужно бояться результата сотни битв.«Вместо того, чтобы пытаться спорить с более крупными конкурентами по вопросам, в которых они работают лучше всего, ищите слабые места, пробелы и другие возможности. Ключом к победе над более крупным конкурентом является сосредоточение внимания на небольших, достижимых победах и пусть они накапливаются со временем.

Климат

Рассматривая климат, сосредоточьтесь на факторах, не связанных с вашим бизнесом, которые могут повлиять на вашу деятельность. Это будет включать отраслевые тенденции, социальные тенденции, правовые тенденции, а также новые или развивающиеся технологии.Задайте себе следующие вопросы:

  1. Есть ли какие-либо новые или предлагаемые законы или постановления, которые могут повлиять на мой бизнес? Если да, то как я планирую их решать?
  2. Существуют ли какие-либо социальные тенденции, которые могут повлиять на то, что люди покупают, или на то, как люди их покупают?
  3. Существуют ли какие-либо экономические тенденции, которые могут повлиять на покупательское поведение покупателей?
  4. Существуют ли какие-либо новые или появляющиеся технологии, которые могут изменить то, как действуют мои клиенты или как работает мой бизнес?
  5. Какие вещи или мнения становятся популярными или непопулярными?

С помощью этих вопросов вы не пытаетесь предсказать будущее, но вы пытаетесь получить общее представление о том, куда движется рынок.Например, изучая социальные тенденции, подумайте о том, как люди думают или чувствуют, и какие вещи важны для них. Например, если ваша целевая аудитория все больше озабочена экологичностью, практикой справедливой торговли или страной-производителем, вам необходимо осознавать эти чувства. Это не только поможет вам привести вашу компанию к успеху, но и поможет избежать потенциальных катастроф. Отличным примером компании, неспособной предсказать технологические тенденции, является Blockbuster, которая, как известно, отказалась от покупки Netflix в 2000 году за 50 миллионов долларов — Blockbuster теперь не существует (за исключением единственного оставшегося магазина с, возможно, лучшей в мире учетной записью в Twitter), и Netflix стоит почти 4 миллиарда долларов.Если бы Blockbuster был лучше осведомлен о тенденциях в отрасли, они могли бы увеличить прибыль на 8000% (и при этом продолжать бизнес!).

5c Пример маркетингового анализа

Подводя итоги, вот краткий пример анализа 5c с использованием британского розничного гиганта Tesco. Смысл анализа 5c состоит в том, чтобы суммировать ваши выводы в короткие, удобоваримые абзацы, поэтому после того, как вы зададите себе вышеперечисленные вопросы, самое время сжать эту информацию до самых важных выводов:

5c Пример анализа: Tesco

  1. Компания: Tesco предлагает в основном бакалейные товары, но она расширилась на несколько других категорий товаров.Tesco работает уже более 100 лет, и для многих людей в Великобритании имя Tesco является синонимом продуктовых магазинов. Tesco одним из первых внедрила новые технологии и активно расширяет свои физические магазины. Tesco стремится улучшить свое присутствие на непродовольственных рынках, а также укрепить свое присутствие в Интернете.
  2. Сотрудников: Tesco сотрудничает с огромным количеством поставщиков продуктов питания и производителей продукции по всему миру, а также управляет полным внутренним персоналом, внешними фрилансерами и подрядчиками.
  3. Клиенты: Клиенты Tesco в основном находятся в Англии и Великобритании, но обслуживают клиентов со всего мира. Клиенты Tesco ожидают удобства, стоимости и качественного обслуживания.
  4. Конкуренты: Основными конкурентами Tesco являются Asda, Sainsbury и Morrisons, каждая из которых борется за место Tesco как крупнейшей сети продуктовых магазинов Великобритании. Asda является дочерней компанией WalMart и получает выгоду от проницательного ценообразования. В Sainsbury больше магазинов, чем у многих конкурентов, но он работает в основном на рынке круглосуточных магазинов, а не на полноценном продуктовом рынке.Morrison’s извлекает выгоду из вертикально интегрированной цепочки поставок и производит многие продукты, которые продает через свои розничные магазины.
  5. Климат: В связи с тенденцией к покупкам в Интернете, Tesco работает над расширением своего присутствия в розничной торговле через Интернет и диверсификацией предложения других продуктов. Более широкое использование приложений для покупки продуктов и введение розничной торговли без кассы также заставляет Tesco одним из первых внедрять новые технологии.

Анализ 5c: ежегодная проверка состояния предприятия

К этому моменту преимущества анализа 5c для вашего бизнеса должны быть очевидны.Это не только отличный способ провести комплексную проверку общего состояния и позиционирования вашего бизнеса, но и будет бесценным инструментом при принятии маркетинговых решений в будущем. Его ценность заключается в простоте, в котором «большие» проблемы, стоящие перед вашим бизнесом, суммируются таким образом, чтобы их можно было легко концептуализировать. Выполняя анализ 5c или другой ситуационный анализ не реже одного раза в год, вы будете в курсе своего бизнеса и конкурентной среды.

Если вы только начинаете продавать в Интернете, анализ 5c все еще может быть очень полезным.Заполнение внешних элементов (например, конкурентов) поможет вам понять конкурентную среду, что поможет вам разработать и позиционировать свой будущий магазин более стратегически. После того, как вы завершили ситуационный анализ своего бизнеса, пришло время применить полученные знания на практике в собственном интернет-магазине. Попробуйте бесплатную 14-дневную пробную версию универсального программного обеспечения для электронной коммерции Volusion и убедитесь сами, почему продавцы Volusion продают в среднем в 2,8 раза больше, чем продавцы, использующие другие платформы.

Удачной продажи!

Есть вопросы о том, как выполнить анализ 5C для вашего собственного интернет-магазина? Задайте нам вопрос в комментариях ниже!

Вычислительное построение трехмерных ансамблей хроматина и прогноз функциональных взаимодействий альфа-глобинового локуса на основе данных 5C | Исследование нуклеиновых кислот

Аннотация

Технологии захвата конформации измеряют частоту взаимодействий между участками хроматина.Однако понимание регуляции генов требует знания детальных пространственных структур гетерогенного хроматина в клетках. Здесь мы описываем метод nC-SAC (n-Constrained-Self Avoiding Chromatin), который преобразует экспериментальные частоты взаимодействия в трехмерные ансамбли цепочек хроматина. nC-SAC сначала отличает специфические частоты взаимодействия от неспецифических, затем генерирует трехмерные ансамбли хроматина, используя идентифицированные специфические взаимодействия в качестве пространственных ограничений. Применение к α-глобиновому локусу показывает, что эти ограничения (~ 20%) управляют образованием ~ 99% всех экспериментально зафиксированных взаимодействий, в которых ~ 30% дополнительных к наложенным ограничениям оказывается специфичным.Также предсказываются многие новые специфические пространственные контакты, не зафиксированные экспериментально. Подмножество, из которого доступны независимые данные ChIA-PET, подтверждено как опосредованное RNAPII, CTCF и RAD21. Их позиционирование в архитектурном контексте навязанных специфических взаимодействий от nC-SAC очень важно. Наши результаты также предполагают наличие многочастичной структурной единицы, включающей ген α-глобина, его энхансеры и ген POL3RK, для регуляции экспрессии α-глобина в молчащих клетках.

ВВЕДЕНИЕ

Центральной проблемой биологии является понимание пространственной организации генома внутри ядра клетки и того, как трехмерное сворачивание генома диктует важные действия клетки, такие как экспрессия генов (1).Недавние разработки захвата конформации хромосом (3C) и родственных техник (4C, 5C, Hi-C) позволили крупномасштабное открытие дальнодействующих взаимодействий петель хроматина между удаленными хромосомными элементами (2-7). Открытие топологически ассоциированных доменов (TAD) с повышенными взаимодействиями хроматина (8,9) предполагает детальную структурную сеть, включающую связывание архитектурных белков (10). Эти находки указывают на вероятные трехмерные структурные единицы хроматина, которые приспосабливают пространственную кластеризацию различных регуляторных элементов и факторов транскрипции, важных для клеточной активности.

Хроматин очень динамичен и испытывает значительные конформационные изменения (11). Поскольку данные 3C усредняются по клеточным популяциям и могут отражать смесь различных конформаций в конкретный момент, важно раскрыть ансамбль трехмерных структур локуса гена и оценить наличие различных структур, которые в совокупности лучше всего описывают объемные измерения ( 12). Это сделало бы возможным точные структурные измерения и идентификацию пространственных организационных единиц геномных элементов.

Чтобы преодолеть ограничения парной природы данных захвата конформации хромосом и получить детальное понимание механизмов регуляции генов, были предприняты значительные усилия по созданию трехмерных структур хроматина. Текущие 3D-модели полимеров можно разделить на модели, управляемые термодинамикой или данными (13). Модели, основанные на термодинамике, основаны на минимальных физических предположениях и иногда включают эмпирически дополнительную информацию, такую ​​как CTCF (14–16), эпигенетические состояния (14,17) или данные, связанные с 3C (18,19).Они раскрыли важную информацию об общих принципах складывания генома (5,14–26). Например, недавняя модель, основанная на энергетическом ландшафте, может воспроизводить экспериментально зафиксированные паттерны взаимодействия генома человека с использованием параметров, полученных из одной хромосомы и перенесенных на другие хромосомы (14). Формирование ТАД (16,17) также можно предсказать. Однако такие модели часто являются общими моделями, которые не предоставляют подробных пространственных структур, необходимых для понимания лежащего в основе механизма дифференциальной экспрессии генов (5,16,17,20–26), или предоставляют детали только о взаимодействиях CTCF (15).Другие имеют ограниченное разрешение для фиксации более тонких структурных различий небольшого локуса (14,18). Хотя в последнее время был достигнут важный успех в идентификации специфических взаимодействий драйверов для небольших локусов (~ 150 кБ) (19), для этого требуется значительный объем моделирования, который трудно масштабировать.

Управляемые данными модели генерируют трехмерный ансамбль хроматиновых цепей с использованием данных, связанных с 3C (4C / 5C / Hi-C), и могут предоставить обширную информацию о биологических свойствах геномных элементов (27–36). Напр., Экспериментально полученные паттерны взаимодействия могут быть воспроизведены с помощью вычислений с простыми предположениями (27,28,31–33,36), с раскрытой совместной локализацией коэкспрессируемых генов (33) и предсказанными границами TAD (36).Однако сложно с помощью вычислений создать хорошо отобранные ансамбли цепочек хроматина с высоким разрешением и количественно оценить возникновение различных конфигураций цепей (29,30). Кроме того, большинство этих моделей были разработаны для изучения общей организации генома и не могут предоставить подробную информацию о конкретном локусе (27,28,31–33,36). Более того, текущие модели на основе ограничений не могут отличить конкретные взаимодействия от неспецифических взаимодействий.

В этом исследовании мы описываем метод n с ограниченным самоизбеганием хроматина (nC-SAC) для построения трехмерного ансамбля структур хроматина на основе измерений, связанных с 3C, и для определения конкретных взаимодействий, которые могут быть важны для управления образованием пространственные структуры локусов генов.Мы фокусируемся на α-глобиновом локусе и предсказываем детальные конфигурации ансамблей хроматиновых цепей на основе ограничений, производных от 5C (29).

Поскольку измерения с помощью методов, связанных с 3C, налагают большое количество ограничений близости, существующие методы, основанные на данных, основанные на пространственных ограничениях, испытывают трудности с различением конкретных взаимодействий от неспецифических взаимодействий (13), которые возникают в результате случайных взаимодействий из-за неспецифических взаимодействий. специфическое столкновение хромосомных участков друг с другом (37).Для решения этой проблемы мы разработали двухэтапный подход. На первом этапе мы изучаем взаимодействия хроматина, возникающие исключительно из-за эффектов конечного объема ядра клетки и природы хроматина, избегающего самоуправления. В частности, мы генерируем 100000 случайных конформаций цепей хроматина, избегающих самопроизвольных действий, внутри переполненного ядра клетки, которые используются в качестве нулевой модели. Затем модель nC-SAC идентифицирует наиболее значимые взаимодействия 5C и отделяет их от неспецифических взаимодействий в α-глобиновом локусе.На втором этапе существенные взаимодействия накладываются как пространственные ограничения для построения трехмерных моделей цепочек хроматина. Используя метод геометрической последовательной выборки по важности (g-SIS), мы преодолеваем серьезные проблемы выборки и генерируем большие ансамбли трехмерных цепочек хроматина локуса α-глобина для двух клеточных линий с разными уровнями экспрессии. Эти ансамбли удовлетворяют ~ 90% наложенных ограничений значительных взаимодействий 5C.

Мы далее исследуем функциональные последствия структур α-глобинового локуса в регуляции генов.Наша структурная модель предсказывает большое количество новых циклических взаимодействий с пространственными деталями, которые не были зафиксированы в исходном эксперименте 5C из-за отсутствия покрытия праймером. Подмножество предсказанных нами взаимодействий показано в двух независимых исследованиях ChIA-PET, которые опосредуются белками, такими как CTCF, RNAPII, RAD21, и связаны с одновременными модификациями гистонов (38,39). Анализ второй нулевой модели, в которой положение пар взаимодействий рандомизировано, показывает, что связь этих недавно обнаруженных взаимодействий с функциональными элементами очень значима.Наша модель также предполагает существование многочастичной структурной единицы, включающей ген α-глобина, энхансеры HS40 / 46/48 и ген POL3RK, для регуляции экспрессии α-глобина в молчащей клеточной линии. Кроме того, наши модели раскрывают глобальные различия в пространственных структурах α-глобина в клетках с высокой и низкой экспрессией. В частности, наши данные предполагают, что гомогенная и доминирующая структурная популяция локуса может быть связана с высоким уровнем экспрессии α-глобина. Кроме того, взаимодействия, идентифицированные методом nC-SAC, включая предсказанные новые взаимодействия, могут играть важную роль в качестве движущих взаимодействий для формирования ансамблевых структур α-глобина.

МАТЕРИАЛЫ И МЕТОДЫ

Общий вычислительный конвейер nC-SAC показан на рисунке 1. На этапе 1 частоты взаимодействия, полученные из исследования 5C (29), сравниваются с частотами взаимодействия случайного ансамбля C-SAC (рисунки 1A и B) ( 40). Для этого создается ансамбль из 100 000 цепей C-SAC (40), ограниченных сферой (рис. 1A). Затем этот ансамбль загружается 1000 раз, и вычисляется P -значение наблюдения экспериментально зафиксированной частоты взаимодействия в случайном ансамбле.Полученные значения P затем корректируются для проверки множественных гипотез (рис. 1C). Прямая зависимость между частотой взаимодействия и пространственным расстоянием наблюдалась экспериментально (41). Таким образом, значимые частоты взаимодействия 5C при уровне ложного обнаружения α <5% (рис. 1D) преобразуются в пространственные расстояния с использованием полугауссовой модели (рис. 1E). На стадии 2 ансамбль из 10 000 трехмерных цепочек хроматина, которые удовлетворяют этим ограничениям пространственного расстояния, затем генерируется с использованием техники g-SIS (Figure 1F).Карта взаимодействия с полным разрешением вычисляется из сгенерированного ансамбля структур (рис. 1G).

Рисунок 1.

Вычислительный конвейер nC-SAC для прогнозирования структурных ансамблей цепочек хроматина на основе данных 5C. ( A ) Взаимодействия случайного трехмерного ансамбля из 10 5 цепочек C-SAC в ядре клетки, генерируемые для получения контактной матрицы случайных взаимодействий. ( B ) 5C-взаимодействия сравнивают с ( C ) 1000 самонастраиваемыми матрицами случайных контактов для вычисления P -значения каждого взаимодействия.( D ) После корректировки FDR для проверки множественных гипотез учитываются только значимые трехмерные взаимодействия. ( E ) Эти оставшиеся важные взаимодействия 5C нормализуются и преобразуются в расстояния с использованием полугауссовой модели. ( F ) Затем при этих ограничениях генерируется ансамбль из> 10 4 3D-цепочек локуса, и ( G ) вычисляется карта контактов с полным разрешением и сравнивается с (B).

Рисунок 1.

Вычислительный конвейер nC-SAC для прогнозирования структурных ансамблей цепочек хроматина на основе данных 5C.( A ) Взаимодействия случайного трехмерного ансамбля из 10 5 цепочек C-SAC в ядре клетки, генерируемые для получения контактной матрицы случайных взаимодействий. ( B ) 5C-взаимодействия сравнивают с ( C ) 1000 самонастраиваемыми матрицами случайных контактов для вычисления P -значения каждого взаимодействия. ( D ) После корректировки FDR для проверки множественных гипотез учитываются только значимые трехмерные взаимодействия. ( E ) Эти оставшиеся важные взаимодействия 5C нормализуются и преобразуются в расстояния с использованием полугауссовой модели.( F ) Затем при этих ограничениях генерируется ансамбль из> 10 4 3D-цепочек локуса, и ( G ) вычисляется карта контактов с полным разрешением и сравнивается с (B).

Сопоставление данных 5C с полимерной цепью

Мы моделируем цепь хроматина α-глобина как ограниченную полимерную цепь, следуя нашему предыдущему исследованию влияния объема ядра клетки на укладку хромосом человека (40). В этой модели мы представляем хроматин как набор шариков, а цепь ограничена частотами взаимодействия 5C и ограничением ядра клетки.Мы делим локус 500 т.п.н. на 184 бусинки, каждая из которых соответствует 2,7 т.п.н. ДНК. Мы использовали фрагменты, чтобы имитировать рестрикционную фрагментацию HindIII. Если фрагмент HindIII короче пяти гранул (~ 13,5 т.п.н.), он представлен одной единицей фрагмента. Фрагменты HindIII длиннее пяти бусинок делятся на множество фрагментов. Каждая единица фрагмента моделируется как твердое тело с максимум пятью бусинами. Мы называем последнюю бусину в каждом блоке узлом, а номер узла используется в качестве идентификатора блока (рис. 2А).Всего мы получаем 54 жестких фрагмента с разной длиной, при этом максимальная длина единицы сохраняется на уровне пяти гранул, чтобы соответствовать свойству изгиба хроматина, что соответствует длине сохранения 150 нм. Альтернативный подход к модели длины персистентности — это подход из (27), где явно вводится энергия изгиба, так что получается распределение углов изгиба, которое соответствует известной длине стойкости хроматина.

Рисунок 2.

Картирование взаимодействий 5C на цепях хроматина модели nC-SAC, идентификация неспецифических взаимодействий и прогнозирование новых взаимодействий между геномными элементами в α-глобиновом локусе.( A ) Картирование α-глобинового локуса размером 500 т.п.н. и взаимодействий 5C на полимерную модель цепи хроматина C-SAC. Стрелки вверх и вниз на линейной диаграмме α-глобинового локуса представляют собой обратный и прямой праймеры на концах фрагментов HindIII (29) соответственно. Фрагменты между праймерными сайтами 25 и 32 увеличены, чтобы продемонстрировать детали модели C-SAC. Чередующиеся фрагменты показаны розовым и желтым цветом. Фрагменты HindIII картируются на единицы фрагмента, при этом изгиб может происходить на сайтах праймера (темно-синий) или в каждой 6-й бусине (розовый) для фрагментов, картированных на одну или несколько единиц.Ансамбль случайных цепочек хроматина C-SAC генерируется путем роста цепи по одной бусине за раз в ограниченной сфере, представляющей ядро ​​клетки (40). Показаны типичные частичные и полные цепи C-SAC в сферическом ограничении. ( B ) Все сообщили о взаимодействиях 5C между элементами в α-глобиновом локусе (29). ( C ) Остающиеся значительные взаимодействия 5C после неспецифических взаимодействий исключены. ( D ) Сравнение статистически значимых взаимодействий 5C (красный кружок) и взаимодействий, предсказанных моделью nC-SAC (бежевые кружки).Количество взаимодействий 5C, захваченных nC-SAC, выделено жирным шрифтом, а не захваченные — в скобках. Среди предсказанных взаимодействий (бежевые кружки) много новых предсказаний (выделено курсивом), которые не были измерены в исходном исследовании 5C.

Рисунок 2.

Картирование взаимодействий 5C на цепях хроматина модели nC-SAC, идентификация неспецифических взаимодействий и прогнозирование новых взаимодействий между геномными элементами в α-глобиновом локусе. ( A ) Картирование α-глобинового локуса размером 500 т.п.н. и взаимодействий 5C на полимерную модель цепи хроматина C-SAC.Стрелки вверх и вниз на линейной диаграмме α-глобинового локуса представляют собой обратный и прямой праймеры на концах фрагментов HindIII (29) соответственно. Фрагменты между праймерными сайтами 25 и 32 увеличены, чтобы продемонстрировать детали модели C-SAC. Чередующиеся фрагменты показаны розовым и желтым цветом. Фрагменты HindIII картируются на единицы фрагмента, при этом изгиб может происходить на сайтах праймера (темно-синий) или в каждой 6-й бусине (розовый) для фрагментов, картированных на одну или несколько единиц. Ансамбль случайных цепочек хроматина C-SAC генерируется путем роста цепи по одной бусине за раз в ограниченной сфере, представляющей ядро ​​клетки (40).Показаны типичные частичные и полные цепи C-SAC в сферическом ограничении. ( B ) Все сообщили о взаимодействиях 5C между элементами в α-глобиновом локусе (29). ( C ) Остающиеся значительные взаимодействия 5C после неспецифических взаимодействий исключены. ( D ) Сравнение статистически значимых взаимодействий 5C (красный кружок) и взаимодействий, предсказанных моделью nC-SAC (бежевые кружки). Количество взаимодействий 5C, захваченных nC-SAC, выделено жирным шрифтом, а не захваченные — в скобках.Среди предсказанных взаимодействий (бежевые кружки) много новых предсказаний (выделено курсивом), которые не были измерены в исходном исследовании 5C.

Этап 1: Идентификация конкретных физических взаимодействий

Сначала мы отбрасываем взаимодействия 5C, связанные с короткими (<2,7 т.п.н.) фрагментами, поскольку они считаются ненадежными (42). Мы также отбрасываем взаимодействия между последовательными фрагментами, поскольку они, вероятно, связаны с эффектами близости (2). Ансамбль из 100000 случайно свернутых полимерных цепей, которые имеют те же физические свойства, что и α-глобиновый локус (53 узла, 183 мономера), генерируется внутри ограниченного пространства ядра с использованием ранее описанной модели C-SAC (40) для оценки статистической значимости каждое взаимодействие 5C.Размер замкнутого пространства равен объему ДНК длиной 500 т.п.н., который, по расчетам, пропорционален диплоидному ядру человека. Следуя экспериментально определенному порогу (19), любые два узла на расстоянии менее 80 нм считаются находящимися в контакте. После нормализации и расчета склонности для каждого взаимодействия (см. Дополнительные методы) значение p для каждого взаимодействия 5C вычисляется путем 1000 раз начальной загрузки случайного ансамбля. После корректировки множественных гипотез, проверяемых с помощью анализа FDR (43) с α = 0.{5C} _ {cell} (i, j) $ | ⁠), обеспечивая при этом свойство самозащиты. Чтобы сгенерировать хроматиновую цепь, мы наращиваем цепь по одному узлу за раз, используя дискретную модель вне решетки с k = 640 состояниями (40,44–48). Новый узел добавлен в растущую цепочку с текущим узлом, расположенным на x t размещается на x t + 1 , который является единицей фрагмента L p расстояние на расстоянии от x т .{5C} _ {cell} (i, j) \ rbrace $ | Ограничения, когда пары ( i, j ) находятся далеко на геномном расстоянии, чрезвычайно сложно, мы вводим стратегию упреждающего смещения, чтобы выбрать пару ( i, j ) из доступных пустых соседних сайтов, которые не имеют ограничений. Мы отслеживаем это смещение и присваиваем каждой успешно сгенерированной цепочке правильный вес | $ w ({\ mbox {x}}) $ | ⁠, который рассчитывается как отклонение распределения выборки относительно целевого распределения | $ \ pi ({\ mbox {x}}) $ | (40,49–50).Хотя смещение вводится для повышения эффективности выборки, оно порождает цепочки, расходящиеся с целевым распределением. Следовательно, вес успешно сгенерированной цепочки используется для корректировки внесенного смещения. Этот вес рассчитывается с использованием дополнительного уравнения (8). Более подробную информацию о смещении при прогнозировании можно найти в (49,50).

РЕЗУЛЬТАТЫ

Определение конкретных взаимодействий 5C

Во время конструирования библиотек 3C хроматина обработка формальдегидом может ковалентно связывать элементы генома в пределах определенных пространственных расстояний, независимо от того, существуют ли специфические взаимодействия (37).Значительное количество таких взаимодействий возникает из-за природы самоизбегания цепей хроматина, заключенных в переполненном ядре клетки (40,22). Поскольку локусы из разных хромосом могут сосуществовать внутри ядра клетки, ядерное ограничение, а также эффекты исключенного объема приводят к ограниченному доступному пространству для отдельного локуса. Мы предположили, что многие взаимодействия 5C носят неспецифический характер, в то время как другие специфичны в том смысле, что они соответствуют определенным архитектурным ограничениям.На первом этапе мы идентифицируем такие специфические и неспецифические взаимодействия. Мы сгенерировали ансамбль из 100 000 случайных цепочек C-SAC (40) (рис. 2A). Без априорной информации мы предполагаем, что α-глобиновый локус размером 500 т.п.н. (5 × 10 5 п.н.) занимает (5 × 10 5 ) / (6 × 10 9 ) доступного пространства ∼7,5 3 мкм 3 внутри среднего клеточного ядра ∼10 3 мкм 3 с размером диплоидного генома человека 2 × 3 × 10 9 п.н.Это соответствует сфере диаметром 330 нм.

Мы загружаем цепочки в случайный ансамбль, чтобы сгенерировать 1000 ансамблей из 100000 цепочек C-SAC и вычислить вероятности наблюдения тех же нормированных частот взаимодействия 5C в этих случайных ансамблях и использовали эти вероятности как P -значений, которые затем подлежит исправлению при проверке множественных гипотез при уровне ложного обнаружения (FDR) α <5% (более подробную информацию см. в разделе «Методы и дополнительные сведения»).Всего 293 из 425 экспериментально зафиксированных 5C-взаимодействий (77%) в клеточной линии GM12878 и 284 из 367 5C-взаимодействий (87%) в клеточной линии K562 не являются статистически значимыми и поэтому считаются неспецифическими и не используется в качестве пространственных ограничений (рис. 2B и C). Только 23% и 13% взаимодействий 5C оказались значимыми в клеточных линиях GM12878 и K562 соответственно. Признавая, что доступное пространство может быть не идеально сферическим, мы используем строгие критерии FDR, чтобы гарантировать, что мы идентифицируем только наиболее значимые взаимодействия, которые будут присутствовать, даже если есть отклонения от идеальной сферической формы.Наши исследования показали, что введение более строгих критериев α = 0,01 приведет к исключению только еще одного взаимодействия для каждой клеточной линии.

Затем мы спросили, согласуются ли взаимодействия 5C, идентифицированные как специфические, с общим наблюдением дальнодействующих взаимодействий хроматина в локусе. Взаимодействия гена α-глобина с его энхансером HS40, а также взаимодействия с соседними сайтами гиперчувствительности HS48 и HS46 были идентифицированы как ключевые факторы, определяющие уровни экспрессии гена α-глобина в клетках мышей, экспрессирующих глобин, в предыдущих исследованиях с нокаутом и 3C ( 51,52).Мы обнаружили, что парные взаимодействия между геном α-глобина и регуляторными элементами HS40, HS46 и HS48 относятся к числу специфических взаимодействий (дополнительный рисунок S1). Более того, эксперименты ChIP-Seq (53) показывают, что эти узлы содержат пики RNAPII (дополнительный рисунок S5). Дополнительные эксперименты ChiA-PET (38,39) показывают, что эти взаимодействия, вероятно, опосредуются RNAPII (дополнительная таблица S2, между парами узлов 11–22 и 12–22), CTCF (дополнительная таблица S4, между парами узлов 11–22, 12). –22 и 13–22), а также RAD21 (cohesin) (дополнительная таблица S5, между парами узлов 11–21 и 12–21).

Несколько специфических взаимодействий приводят к образованию большинства контактов 5C

На стадии 2 с использованием метода nC-SAC генерируются трехмерные структурные модели локуса α-глобина, которые удовлетворяют взаимодействиям 5C, идентифицированным как специфические. Следуя предыдущим исследованиям (6,29,30,33), а также экспериментальным наблюдениям (41), мы предполагаем обратную зависимость между частотами 5C и пространственными расстояниями и используем простую полугауссову модель для сопоставления частот значимых взаимодействий 5C с пространственными расстояния между узлами (подробно см. Материалы и методы и SI).Эти пространственные расстояния затем рассматриваются как физические ограничения, которым должны удовлетворять цепочки трехмерного хроматина. Затем для клеточных линий GM12878 и K562 генерируются два отдельных ансамбля из 10 000 хроматиновых цепей α-глобинового локуса (дополнительный рисунок S2).

Ансамбли хроматина α-глобина, созданные с использованием специфических взаимодействий 5C, пропускают только два взаимодействия из 425 взаимодействий 5C в клеточной линии GM12878 и пропускают только два взаимодействия из 367 взаимодействий 5C в клеточной линии K562.То есть 99% всех взаимодействий 5C фиксируются в построенных 3D-ансамблях. Для дальнейшего анализа биологически специфических взаимодействий в прогнозируемом трехмерном ансамбле мы исключили любое взаимодействие, которое присутствует в случайном ансамбле C-SAC с высокой вероятностью, используя ту же технику самонастройки этапа I на уровне FDR 5%.

Мы оценили, насколько хорошо специфические взаимодействия сгенерированных трехмерных ансамблей цепей хроматина удовлетворяют наложенным ограничениям, мы обнаружили, что они захватывают 78 (94%) и 113 (86%) навязанных значимых взаимодействий 5C для клеточных линий K562 и GM12878, соответственно (рисунок 2D).Дальнейшее исследование показало, что 74 и 122 дополнительных взаимодействия, не наложенных как ограничения, также повторно фиксируются как следствие наложенных ограничений. Когда рассматриваются все взаимодействия 5C, nC-SAC идентифицирует 41% и 55% из них как специфические для клеточных линий K562 и GM12878, несмотря на то, что только небольшая часть (13–23%) из них используется в качестве ограничений. Здесь зафиксированные взаимодействия в ансамбле nC-SAC — это взаимодействия между узлами, которые определены как имеющие расстояния ниже порога 80 нм и со значительно большей склонностью по сравнению со случайным ансамблем на уровне 5% скорости FDR.Эти наблюдения показывают, что, хотя наш консервативный подход к исключению несущественных взаимодействий является строгим и только наиболее значимые взаимодействия налагаются в качестве ограничений, трехмерные ансамбли хроматиновых цепей, генерируемые nC-SAC, могут выявить множество дополнительных взаимодействий 5C, которые являются физическими и могут быть биологическими. соответствующие.

Эти результаты также показывают, что 13–23% необработанных взаимодействий 5C достаточны, чтобы вызвать дополнительные 30% взаимодействий 5C. То есть формирование ряда экспериментально зафиксированных взаимодействий обусловлено небольшим количеством конкретных взаимодействий.Кроме того, предсказанные цепи хроматина α-глобинового локуса обнаруживают множество новых взаимодействий, не представленных в исходных данных 5C (278 и 301 взаимодействия в клеточных линиях GM12878 и K562, соответственно).

nC-SAC обнаруживает структурные различия α-глобинового локуса

Существуют глобальные структурные различия в организации локуса гена α-глобина между клетками K562 и GM12878, как видно на тепловых картах пространственных взаимодействий из предсказанных цепей α-глобина (рис. 3A).В целом, α-глобиновый локус молчащей клеточной линии GM12878 образует единую компактную глобулу хроматина. Напротив, цепи активной клеточной линии K562 удлиняются, образуя две невзаимодействующие глобулы, которые демонстрируют два отдельных домена на тепловой карте (рис. 3А). Эти результаты согласуются с предыдущими результатами (29). Дополнительные глобальные и локальные структурные различия были обнаружены с использованием алгоритма кластеризации на основе плотности (54) (Дополнительные методы). Два типа разделения ансамбля трехмерных цепочек хроматина каждой клеточной линии на кластеры на основе (i) радиуса вращения модельных цепочек хроматина и (ii) среднеквадратичных отклонений, полученных из соответствующих попарных расстояний между двумя внутрицепочечными узлы выполняются для предоставления информации о глобальной гетерогенности цепей хроматина на основе их открытости или компактности, а также того, насколько хорошо цепи хроматина в ансамбле поддерживают подробные взаимодействия 5C, которые могут быть необходимы для экспрессии генов.

Рисунок 3.

Ансамбли предсказанных трехмерных цепей хроматина α-глобинового локуса. Взаимодействия между геномными элементами локуса α-глобина из предсказанных структурных ансамблей из 10 000 цепей хроматина в молчаливых линиях клеток GM12878 и активных клеточных линиях K562. ( A ) Тепловые карты пространственных взаимодействий α-глобинового локуса, включая необработанные подсчеты 5C, наиболее значимые подсчеты 5C после исключения неспецифических взаимодействий при коррекции FDR и взаимодействия из смоделированных структурных ансамблей.Нормализованная частота взаимодействий i j обозначена цветом. Интенсивность красного цвета указывает на повышенную частоту. ( B ) Гистограмма (вверху) показывает долю структур, связанных с различными структурными кластерами (K562, синий; GM12878, красный), при группировании по различиям в радиусах вращения между цепями. Преобладающие трехмерные структуры, связанные со структурными кластерами 1 и 2, также показаны для обеих клеточных линий. ( C ) Гистограмма (вверху) показывает долю структур, связанных с различными структурными кластерами (K562, синий; GM12878, красный), при кластеризации по попарным различиям между узлами смоделированных цепей хроматина.Преобладающие трехмерные структуры, связанные со структурными кластерами 1 и 2, также показаны для обеих клеточных линий.

Рисунок 3.

Ансамбли предсказанных трехмерных цепочек хроматина α-глобинового локуса. Взаимодействия между геномными элементами локуса α-глобина из предсказанных структурных ансамблей из 10 000 цепей хроматина в молчаливых линиях клеток GM12878 и активных клеточных линиях K562. ( A ) Тепловые карты пространственных взаимодействий α-глобинового локуса, включая необработанные подсчеты 5C, наиболее значимые подсчеты 5C после исключения неспецифических взаимодействий при коррекции FDR и взаимодействия из смоделированных структурных ансамблей.Нормализованная частота взаимодействий i j обозначена цветом. Интенсивность красного цвета указывает на повышенную частоту. ( B ) Гистограмма (вверху) показывает долю структур, связанных с различными структурными кластерами (K562, синий; GM12878, красный), при группировании по различиям в радиусах вращения между цепями. Преобладающие трехмерные структуры, связанные со структурными кластерами 1 и 2, также показаны для обеих клеточных линий. ( C ) Гистограмма (вверху) показывает долю структур, связанных с различными структурными кластерами (K562, синий; GM12878, красный), при кластеризации по попарным различиям между узлами смоделированных цепей хроматина.Преобладающие трехмерные структуры, связанные со структурными кластерами 1 и 2, также показаны для обеих клеточных линий.

Результаты глобальной кластеризации показали, что ансамбль неэкспрессирующей клеточной линии GM12878 однороден по радиусу инерции с общим небольшим количеством кластеров (всего ~ 26), причем наиболее населенный кластер составляет ~ 85% от общего количества кластеров. цепи хроматина в ансамбле. Напротив, ансамбль экспрессирующей α-глобин клеточной линии K562 глобально разнообразен и содержит множество кластеров (всего ~ 299), причем наиболее заметный кластер составляет только <1% от всего ансамбля (Рисунок 3B).Когда выполняется второй тип кластеризации, ансамбль α-глобина, экспрессирующего клеточную линию K562, является в высшей степени однородным с в целом небольшим количеством кластеров (всего ~ 13), причем наиболее населенный кластер составляет ~ 97% от общего количества кластеров. цепи хроматина в ансамбле. Напротив, ансамбль неэкспрессирующей клеточной линии GM12878 разнообразен детализированными локальными взаимодействиями с множеством различных кластеров (всего ~ 148), причем наиболее заметный кластер составляет только ~ 24% от всего ансамбля (рис. 3C). ).Эти результаты подчеркивают компактность трехмерных цепей в неэкспрессирующей клеточной линии и открытость трехмерных цепей в экспрессирующих клеточных линиях, что согласуется с предыдущими результатами (29). Наши результаты также показывают, что существуют значительные различия в субпопуляционной гетерогенности цепей хроматина в локальных взаимодействиях между двумя линиями клеток.

nC-SAC предсказывает новые взаимодействия, опосредованные белками CTCF, RNAPII и RAD21

В контексте ограничений, проистекающих из конкретных частот, мы прогнозируем существование дополнительно 504 и 457 дальнодействующих взаимодействий в α-глобиновом локусе для клеточных линий GM12878 и K562, соответственно.Эти специфические взаимодействия наблюдаются значительно чаще в ансамбле nC-SAC по сравнению со случайным ансамблем C-SAC на уровне FDR 5%. Чтобы определить биологическую значимость этих взаимодействий, которые не налагаются в качестве ограничений, мы изучили результаты двух независимых исследований ChIA-PET клеток K562 (38,39) и исследования ChIA-PET клеток GM12878 (39). Эти исследования ChIA-PET выявили петлевые взаимодействия в α-глобиновом локусе, опосредованные связыванием RNAPII, CTCF и RAD21, а также взаимодействия, связанные с модификациями гистонов (38,39).

Среди 68 RNAPII-опосредованных взаимодействий в клетках K562, обнаруженных с помощью ChIA-PET (38) (рис. 4A, синий кружок на диаграмме Венна и рис. 4B1, синие и серые дуги), 33 также предсказываются nC-SAC (рис. 4А, оранжевый кружок). Примечательно, что 21 из 33 предсказанных взаимодействий являются новыми взаимодействиями, отсутствующими в измерениях 5C (Рисунок 4B2, красные дуги), а 12 — взаимодействия, зафиксированные измерениями 5C (Рисунок 4B3, зеленые дуги). Среди 35 RNAPII-опосредованных взаимодействий, не обнаруженных nC-SAC (рис. 4B1, серые дуги), 26 не имеют покрытия праймером и, следовательно, не отражаются в данных 5C.Остальные 9 взаимодействий, опосредованных RNAPII, имеют низкий уровень взаимодействий 5C или не имеют их вообще, что накладывает очень слабые ограничения на нашу модель. Отдельное исследование ChIA-PET (39) выявило еще два опосредованных RNAPII взаимодействия между геном α-глобина (узел 21) и HS40 (узел 12), которые также предсказываются nC-SAC и присутствуют в измерениях 5C (дополнительная таблица S1). .

Рисунок 4.

Прогнозирование новых взаимодействий между геномными элементами в α-глобиновом локусе и проверка их биологической значимости. (A, C, E, G ) Сравнение петлевых взаимодействий, обнаруженных с помощью ChIA-PET (38) и предсказанных ансамблем nC-SAC 3D взаимодействий в клетках K562. На диаграммах Венна показаны измеренные взаимодействия ChIA-PET (синие кружки) и предсказанные nC-SAC (оранжевые кружки). ( B1, D1, F1, h2 ) Циркулярные диаграммы показывают взаимодействия, обнаруженные с помощью ChIA-PET (синие дуги для зафиксированных взаимодействий с помощью 3D-модели и серые дуги для взаимодействий, которые отсутствуют в 3D-модели), ( B2, D2, F2, h3 ) предсказанные nC-SAC взаимодействия, обнаруженные ChIA-PET, но отсутствующие в 5C (красные дуги), ( B3, D3, F3, h4 ) взаимодействия, предсказанные nC-SAC и захваченные 5C и ChiA-PET техники (зеленые дуги).

Рисунок 4.

Прогнозирование новых взаимодействий между геномными элементами в α-глобиновом локусе и подтверждение их биологической значимости. (A, C, E, G ) Сравнение петлевых взаимодействий, обнаруженных с помощью ChIA-PET (38) и предсказанных ансамблем nC-SAC 3D взаимодействий в клетках K562. На диаграммах Венна показаны измеренные взаимодействия ChIA-PET (синие кружки) и предсказанные nC-SAC (оранжевые кружки). ( B1, D1, F1, h2 ) Циркулярные диаграммы показывают взаимодействия, обнаруженные с помощью ChIA-PET (синие дуги для зафиксированных взаимодействий с помощью 3D-модели и серые дуги для взаимодействий, которые отсутствуют в 3D-модели), ( B2, D2, F2, h3 ) предсказанные nC-SAC взаимодействия, обнаруженные ChIA-PET, но отсутствующие в 5C (красные дуги), ( B3, D3, F3, h4 ) взаимодействия, предсказанные nC-SAC и захваченные 5C и ChiA-PET техники (зеленые дуги).

Мы также исследовали опосредованные CTCF взаимодействия в клетках K562, обнаруженные с помощью ChIA-PET (38). Среди 11 сообщенных взаимодействий (рисунок 4C, синий кружок на диаграмме Венна и рисунок 4D1, синие и серые дуги) (38), восемь предсказываются моделью nC-SAC (рисунок 4C, оранжевый кружок). Из них шесть отсутствуют в измерениях 5C (рисунок 4D2, красные дуги), а два взаимодействия фиксируются в измерениях 5C (рисунок 4D3, зеленые дуги). Три CTCF-опосредованных взаимодействия, обнаруженные с помощью ChiA-PET, но не обнаруженные nC-SAC (рис. 4D1, серые дуги), либо не имеют частоты 5C, либо не имеют покрытия праймером, поэтому не накладывают никаких ограничений на нашу модель.

Кроме того, мы исследовали RAD21-опосредованные взаимодействия в клетках K562, обнаруженные в недавнем исследовании ChIA-PET (39). Среди восьми описанных взаимодействий (рисунок 4E, синий кружок на диаграмме Венна и рисунок 4F1, синие и серые дуги) пять предсказываются моделью nC-SAC (рисунок 4E, оранжевый кружок), три из них являются новыми взаимодействиями, которые являются отсутствует в измерениях 5C (рис. 4F2, красные дуги), и два взаимодействия фиксируются в измерениях 5C (рис. 4F3, зеленые дуги). Три RAD21-опосредованные взаимодействия, обнаруженные с помощью ChiA-PET, но не обнаруженные nC-SAC (рис. 4F1, серые дуги), не имеют покрытия 5C, что не накладывает ограничений на нашу модель.

Мы дополнительно исследовали RAD21-опосредованные взаимодействия в молчащих клетках GM12878, обнаруженные с помощью исследования ChIA-PET (39). Среди четырех описанных взаимодействий (рисунок 4G, синий кружок на диаграмме Венна и рисунок 4h2, синие и серые дуги) три предсказываются моделью nC-SAC (рисунок 4G, оранжевый кружок), включая одно новое взаимодействие, отсутствующее в 5C. исследования (рис. 4h3, красные дуги), а также двух взаимодействий, зафиксированных 5C (рис. 4h4, зеленые дуги). Единственное необнаруженное взаимодействие (рис. 4h2, серые дуги) не имеет покрытия 5C, что не накладывает ограничений на нашу модель.

В целом, наш метод nC-SAC предсказал 52% из 68 взаимодействий, опосредованных RNAPII, 75% из 11 взаимодействий, опосредованных CTCF, 62% из 8 взаимодействий, опосредованных RAD21, в линии клеток K562, 86% из 7 взаимодействий. взаимодействия, которые связаны с модификациями гистонов в клеточной линии K562, и 80% 5 RAD21-опосредованных взаимодействий в клеточной линии GM12878 (дополнительные таблицы S1 – S6). Всего с помощью ChiA-PET в клеточной линии K562 обнаружено 89 взаимодействий, и 52 из них относятся к 457 предсказанным значимым взаимодействиям.Чтобы оценить значимость функционального обогащения предсказанных взаимодействий, мы построили нулевую модель, в которой положения функциональных пар случайным образом перераспределяются с использованием того же трехмерного ансамбля цепочек хроматинов, построенного при тех же ограничениях 5C. Среди 100000 случаев случайного перераспределения 89 взаимодействий, обнаруженных ChIA-PET, значение P , равное 52 или более взаимодействиям, определено nC-SAC как значимое, является небольшим ( P <10 −5 , дополнительный рисунок S3).Эти результаты предполагают, что наши предсказанные взаимодействия действительно являются функциональными взаимодействиями и конкретно расположены по отношению к ограничениям 5C.

nC-SAC предсказывает новые взаимодействия, связанные с одновременными модификациями гистонов

Затем мы исследовали взаимодействия, которые, как было установлено, связаны с модификациями гистонов в клетках K562 в недавнем исследовании ChIA-PET (39). Из семи описанных взаимодействий шесть из них предсказываются моделью nC-SAC, три из них являются новыми взаимодействиями, которые отсутствуют при измерении 5C, а три из них отражены в исследовании 5C.Единственные необнаруженные взаимодействия не имеют покрытия 5C (дополнительная таблица S1).

Наши результаты согласуются с выводом о том, что расположение функциональных геномных элементов в петлях хроматина важно для регуляции экспрессии генов (55). Наши результаты также согласуются с важностью специфического позиционирования CTCF по отношению к функциональным геномным элементам (15). Более того, наши результаты предполагают, что некоторые из небольшого числа взаимодействий, используемых в качестве входных ограничений при построении моделей nC-SAC, могут функционировать как взаимодействия драйверов, введение которых приводит к образованию специфических взаимодействий между функциональными сайтами.

nC-SAC предсказывает подробные трехмерные структурные взаимодействия

Считается, что экспрессия гена α-глобина регулируется посредством взаимодействий энхансер-промотор (29). Соответственно, взаимодействие между геном α-глобина и энхансерами HS40 / 46/48 обнаруживается в 90% предсказанных цепей активных клеток K562. Это ожидаемо, поскольку взаимодействие между геном α-глобина и энхансерами HS40 / 46/48 идентифицируется на стадии I и вводится на стадии II. Однако это означает увеличение только в 1 раз.29 по сравнению с молчащими клетками GM12878, поскольку это взаимодействие также присутствует в 69,8% предсказанных цепей клеток GM12878 (фиг. 5A). Наши результаты согласуются с предыдущим исследованием ChIA-PET, в котором обнаружено, что взаимодействия между HS40 и геном α-глобина опосредуются RAD21 в молчащей клеточной линии GM12878 (рис. 4G и H) (39). Эти наблюдения показывают, что взаимодействия промотор-энхансер α-глобина сами по себе не определяют уровень экспрессии, и могут быть задействованы дополнительные регуляторные элементы.

Рисунок 5.

Трехстороннее взаимодействие POL3RK: ген α-глобина: энхансеры, вероятно, является уникальной особенностью неэкспрессирующих клеток GM12878. ( A ) Круговые диаграммы, изображающие процентное соотношение ансамблей, которые имеют двухсторонние (α-глобин: энхансер, светло-зеленый) и трехсторонний (POL3RK: α-глобиновый ген: энхансеры, темно-зеленый) взаимодействия в обоих GM12878 и клеточные линии K562. ( B ) Пространственные структуры хроматина локуса α-глобина были реконструированы из предсказанных nC-SAC трехмерных цепей хроматина с энхансерами HS40 / 46/48 (красный), POL3RK (оранжевый) и геном α-глобина (синий ) изображен.Показанные структуры взяты из наиболее населенных кластеров клеток GM12878 и K562. ( C ) Схематическое изображение трехчастичного взаимодействия гена α-глобина (синий), энхансера (красный), POL3RK (оранжевый), наблюдаемого в клетках GM12878. ( D ) Пространственные расстояния между энхансерами HS40 / 46/48 (красный), POL3RK (оранжевый) и геном α-глобина (синий) единицы трехстороннего взаимодействия в репрезентативной структуре, изображенной на (B) .

Рисунок 5.

Трехстороннее взаимодействие POL3RK: ген α-глобина: энхансеры, вероятно, является уникальной особенностью неэкспрессирующих клеток GM12878.( A ) Круговые диаграммы, изображающие процентное соотношение ансамблей, которые имеют двухсторонние (α-глобин: энхансер, светло-зеленый) и трехсторонний (POL3RK: α-глобиновый ген: энхансеры, темно-зеленый) взаимодействия в обоих GM12878 и клеточные линии K562. ( B ) Пространственные структуры хроматина локуса α-глобина были реконструированы из предсказанных nC-SAC трехмерных цепей хроматина с энхансерами HS40 / 46/48 (красный), POL3RK (оранжевый) и геном α-глобина (синий ) изображен. Показанные структуры взяты из наиболее населенных кластеров клеток GM12878 и K562.( C ) Схематическое изображение трехчастичного взаимодействия гена α-глобина (синий), энхансера (красный), POL3RK (оранжевый), наблюдаемого в клетках GM12878. ( D ) Пространственные расстояния между энхансерами HS40 / 46/48 (красный), POL3RK (оранжевый) и геном α-глобина (синий) единицы трехстороннего взаимодействия в репрезентативной структуре, изображенной на (B) .

Мы исследовали предсказанные nC-SAC трехмерные структуры для клеток K562 и GM12878, чтобы оценить наличие других петлевых взаимодействий, которые могут регулировать экспрессию α-глобина (рис. 5A – D).Хотя трудно сравнивать абсолютные частоты взаимодействия между линиями клеток, мы можем сравнить относительные доли цепей хроматина, содержащих определенные взаимодействия, в каждой линии клеток.

Сначала мы идентифицируем пространственные взаимодействия, в которых ген α-глобина и энхансеры участвуют одновременно в двух клеточных линиях (дополнительный рисунок S4). Это позволило нам дополнительно изучить взаимодействия более высокого порядка с участием других узлов, помимо α-глобина и энхансеров, но происходящие исключительно в одной клеточной линии.Мы перекрыли эпигенетические профили каждого из этих дифференциально взаимодействующих узлов и идентифицировали те, которые связаны с эпигенетическими метками (дополнительные рисунки S4 и S5). На основании этого анализа наше исследование nC-SAC предсказывает, что ген POL3RK участвует в трехстороннем взаимодействии с геном α-глобина и энхансерами в 70% структур хроматина α-глобина из клеток GM12878. Напротив, ген POL3RK имеет гораздо более низкую частоту трехстороннего взаимодействия (18%) с геном α-глобина и энхансерами в клетках K562 (рис. 5A).Предсказанное взаимодействие между POL3RK и энхансерами не было обнаружено в исходном исследовании 5C из-за стратегии конструирования праймеров. (29). С помощью явно сгенерированных трехмерных структур мы можем измерить точные евклидовы расстояния между геномными элементами в отдельных цепочках и вычислить их средние по ансамблю. Мы обнаружили, что цепи из клеток GM12878 с трехчастичным взаимодействием POL3RK: α-глобин: энхансеры имеют средние попарные расстояния между элементами (50,1 ± 20 нм, 62,4 ± 18 нм и 80,0 ± 5 нм) короче или близки к порогу взаимодействия (∼ 80 ± 5 нм), данные в предыдущих исследованиях (19) (дополнительная таблица S7, рисунок 5D).Напротив, усредненные пространственные расстояния POL3RK: α-глобин (∼135 ± 20 нм) и POL3RK: энхансеры (∼140 ± 18 нм) в активных клетках K562 оба намного длиннее, чем этот порог (дополнительная таблица S7).

Мы предполагаем, что трехстороннее петлевое взаимодействие POL3RK с геном α-глобина и энхансерами может блокировать доступ факторов транскрипции к элементам транскрипции α-глобина, тем самым подавляя экспрессию α-глобина (Рисунок 5B – D). Этот отказ в доступе может усугубляться, если факторы транскрипции, связанные с геном POL3RK, занимают большую часть доступного пространства.Этот сценарий согласуется с эпигенетическими данными, в которых POLR3K в молчащих клетках GM12878 обогащен факторами транскрипции, связывающими Pu.1 и Sp1, и модификациями гистонов h3A.Z и h4Kme2, оба из которых связаны с активацией транскрипции (дополнительный рисунок 5). (53). Кроме того, это также согласуется с наблюдаемым отсутствием модификаций h4K4me2 на энхансерах α-глобина в молчащих клетках, что связано с обилием связывания факторов транскрипции, а также с отсутствием обогащения RNAPII, что связано с отсутствием гена. выражение (дополнительный рисунок S5).

ОБСУЖДЕНИЕ

Мы описываем метод nC-SAC, который может преобразовывать 2D карты Chromosome Conformation Capture частоты взаимодействий в популяцию трехмерных цепочек хроматина. Наш метод идентифицирует наиболее значимые пространственные взаимодействия, преодолевает проблему выборки и генерирует большое количество правильно отобранных самоизбегающих цепочек хроматина, которые удовлетворяют ограничениям, налагаемым взаимодействиями 5C. Хотя его разрешение ограничено разрешением фрагментов HindIII в этом исследовании (5–13 т.п.н.) и не предоставляется прямая информация о динамике хроматина, этот метод позволяет нам исследовать структурные свойства локуса α-глобина, позволяя измерять структуру и расстояние на уровне популяции в соответствии с основными требованиями физических цепей хроматина и взаимодействий 5C.

В то время как структуры α-глобинового локуса на основе взаимодействий 5C были смоделированы в исходной статье 5C (29), в этом раннем исследовании оставалось несколько вопросов, оставшихся без ответа. Во-первых, ожидаемые взаимодействия были определены методом сглаживания LOESS (29), который требует наличия частот взаимодействия 5C на каждом интервале геномного расстояния. Из-за редкости фрагментов HindIII получение адекватного размера выборки для точного сглаживания LOESS является сложной задачей. Это влияет на точность моделирования конструкций.Например, Bau et al. предсказал, что взаимодействия между HS40 и геном α-глобина в клеточной линии GM12878 соответствуют ожидаемым при сглаживании LOESS. Однако недавние данные ChiA-PET показали, что взаимодействие между HS40 и α-глобиновым локусом является статистически значимым и опосредовано RAD21 (39). Используя наши строгие критерии FDR, это взаимодействие в клеточной линии GM12878 было обнаружено как значимое с помощью nC-SAC, что согласуется с наблюдениями ChiA-PET. Во-вторых, каждый фрагмент HindIII в исх.(29) был смоделирован как единая сфера, размер которой пропорционален ее геномной длине. Это привело к появлению огромных бусинок с нереалистичными исключенными объемами в некоторых местах полимерной модели. Например, фрагмент HindIII, содержащий 30 т.п.н. ДНК, будет соответствовать бусинке ∼300 нм согласно (29). Это также предотвратило предсказание подробных взаимодействий за пределами разрешения данных 5C. В-третьих, гены HS40 и α-глобина тесно взаимодействовали в локусе в клетках K562 согласно (29), но на расстоянии 159.1 нм. Это большое расстояние, которое следует учитывать для регуляторных взаимодействий энхансер-промотор. Напротив, наша модель предсказывает среднее расстояние 68 нм для взаимодействия между HS40 и геном α-глобина в клеточной линии K562 (рис. 5D). В целом, устраняя чрезмерные ограничения нереалистичных радиусов шариков и улучшая выборку, наша модель обеспечивает более точное описание ансамблевых структур α-глобинового локуса.

Наши результаты, представленные здесь, показывают, что неспецифические пространственные взаимодействия, возникающие из-за ядерного ограничения и эффекта исключенного объема, имеют существенное значение при измерениях 5C, так как до ~ 70-90% взаимодействий 5C могут быть учтены, когда само избегание цепей хроматина ограничены доступным пространством переполненного ядра.Чтобы защититься от ложных срабатываний, мы фокусируемся на дальнодействующих взаимодействиях, обнаруживаемых с максимальной статистической достоверностью. Поскольку эта стратегия является довольно консервативной, часть взаимодействий 5C, которые временно исключены, появляются впоследствии в построенных трехмерных структурах ансамбля, вероятно, в результате ограничений из-за более сильных взаимодействий и ограничения самоускользающих цепей хроматина. Хотя повторное появление таких взаимодействий в нашей модели не гарантирует, что мы сможем обнаружить все функционально значимые умеренные или слабые взаимодействия, мы признаем, что их обнаружение с высокой точностью является сложной задачей в этой области.Кроме того, наш подход не слишком чувствителен к выбору таких параметров, как диаметр сферического ограничения. В то время как недавние исследования показывают, что пространственное ограничение является основным детерминантом организации генома (22,40), так как большая часть правил масштабирования, включая показатель вероятности образования петель, может быть объяснена ограничением самопереходных цепей хроматина, масштабирование Показатель степени α изменяется очень медленно с изменением диаметра ядра в соответствующем режиме размера (40).Следовательно, при строгом уровне ложного обнаружения умеренные изменения диаметра ядра и отклонения от сферической формы вряд ли повлияют на идентификацию наиболее значимых взаимодействий 5C.

Наша модель показывает, что даже несмотря на то, что цепи хроматина принимают разную степень компактности, постоянно наблюдаются важные взаимодействия. Эти взаимодействия широко проявляются в конфигурациях цепей хроматина в активной клеточной линии. Это открытие предполагает наличие общего детального структурного каркаса в активной клеточной линии, который необходим для экспрессии α-глобина.Модель nC-SAC дополнительно позволяет исследовать структуру субпопуляций цепей хроматина, принимающих различные конфигурации. Как показали недавние исследования отдельных клеток, клетки с идентичной гормональной стимуляцией могут демонстрировать различные уровни экспрессии генов, гены с высокой экспрессией на уровне популяции могут иметь бимодальное распределение, а эпигенетические модификации могут быть очень гетерогенными (56-58). Доступ к трехмерным структурам хроматина субпопуляций клеток поможет понять структурное разнообразие цепей хроматина, связанное с гетерогенностью экспрессии генов и эпигенетическими модификациями.

Наш метод может сделать много подробных прогнозов пространственных взаимодействий между удаленными геномными элементами, некоторые из которых подтверждены доступными исследованиями ChIA-PET. Исключая места, в которых отсутствует покрытие 5C, или места, где измерения ChIA-PET и 5C расходятся, наша модель восстановила все оставшиеся RNAPII, CTCF и RAD21 опосредованные дальнодействующие взаимодействия хроматина, а также взаимодействия, связанные с одновременными модификациями гистонов. Хотя мы не можем экстраполировать, чтобы объявить все новые взаимодействия, предсказанные нашей моделью, биологически важными, общая проверка ChIA-PET предполагает, что наш метод может делать подробные предсказания, которые имеют биологическое значение.Для дальнейшей проверки наших прогнозов необходимы дополнительные экспериментальные исследования с более высоким разрешением (<100 кб), чем анализ 3D-FISH.

Наш метод может также предложить высокоспецифичные и проверяемые механистические модели регуляции генов. В то время как измерение 5C выявило многие важные взаимодействия хроматина, детали наших предсказанных цепей хроматина предполагают сложный многочастичный механизм регуляции генов, который выходит за рамки простой модели гена-энхансера. Хотя ген α-глобина и энхансеры HS40 / 46/48 взаимодействуют в обеих клеточных линиях, энхансеры сильно взаимодействуют с POL3RK в «молчащих», но не в активных клетках.Поскольку обнаружено, что POL3RK имеет связанные факторы транскрипции, мы предполагаем, что он может блокировать доступ энхансеров к факторам, необходимым для активации α-глобина в молчащих клетках. Этот механизм инактивации гена через отказ в доступе также согласуется с эпигенетическими профилями энхансеров и гена POL3RK в обеих клеточных линиях. По аналогии с механизмом многогенного комплекса для ко-транскрипции, в котором промотор первого гена действует как энхансер второго гена (38), может быть задействован многогенный комплекс для инактивации.Поскольку доступность связывания факторов транскрипции является ключевой детерминантой регуляции гена (59), ген POL3RK в этом случае может действовать на энхансеры гена альфа-глобина как глушитель посредством отказа в доступе факторов транскрипции. Хотя эти прогнозы довольно умозрительны, они могут быть проверены генетическим возмущением идентифицированной многокомпонентной структурной единицы. В то время как недавние исследования Hi-C (60) могут идентифицировать взаимодействия хроматина с высоким разрешением, открытие этого многочастичного механизма было бы невозможно без построения трехмерного ансамбля структур из-за попарной природы техники Hi-C.Дальнейшее сравнение наших результатов с данными Hi-C с высоким разрешением (5 кб) показало, что 66% и 65% предсказанных взаимодействий оказались статистически значимыми в исследовании Hi-C клеточных линий GM12878 и K562, соответственно. Такой уровень согласия может указывать на то, что наш метод nC-SAC может использовать экспериментальные наблюдения с низким разрешением и создавать структуры, совместимые с наблюдениями с более высоким разрешением. Важность 3D-модели взаимодействий хроматина была также продемонстрирована в недавнем исследовании, в котором были обнаружены многочастичные взаимодействия между генами Sox9 и Kcnj2 (18).

Наше исследование также предполагает, что интеграция трехмерных моделей хроматиновых цепей с эпигенетическими данными может раскрыть понимание механизмов регуляции активности клеток. Хотя общегеномные эпигенетические исследования, такие как обогащение CTCF и модификация гистонов, указывают на потенциальные регуляторные элементы и предполагают возможные дальнодействующие взаимодействия вдоль одномерного генома (53), интерпретировать и интегрировать такую ​​информацию сложно. Недавние исследования показали, что важные организационные свойства генома, такие как образование TADs, могут быть выведены из интеграции данных эпигенома с построением трехмерной структуры (15-17).В этом направлении, проецируя эпигенетические данные на предсказанные трехмерные цепочки хроматина, мы показали, что можно получить лучшее понимание сложных многочастичных механизмов регуляции генов, которые включают в себя несколько геномных элементов.

Наш метод является общим и может применяться для определения конфигурации локусов других генов. Однако успешные прогнозы ограничены доступностью, согласованностью и разрешающей способностью экспериментальных измерений. Кроме того, хотя наш метод может прогнозировать новые взаимодействия, такие прогнозы можно делать только в районах с обширной контактной информацией.По мере того, как плотность экспериментально зафиксированных взаимодействий уменьшается, успешные прогнозы становятся менее вероятными. В принципе, любые 3C и связанные данные (4C / 5C / Hi-C) могут использоваться в качестве пространственных ограничений для вывода трехмерных ансамблей хроматина. При дополнительной разработке алгоритма метод nC-SAC может быть дополнительно улучшен, чтобы он мог генерировать трехмерные ансамбли хроматинов из данных Hi-C с высоким разрешением. Чтобы включить данные Hi-C, потребуется дальнейшее улучшение выборки с помощью более сложных методов повторной выборки и контроля отбраковки, чтобы позволить исследования более длинных цепочек хроматина при включении большего количества пространственных ограничений.Таким образом, метод nC-SAC может моделировать структуры хроматина локусов генов в популяциях и субпопуляциях клеток с различными уровнями экспрессии. Он также обеспечивает новый подход к идентификации пространственных структур и взаимодействий и к оценке их роли в регуляции активности генов. Эти результаты указывают на захватывающие возможности использования ограниченных и попарных данных захвата конформации хромосом посредством моделирования трехмерных структур хроматина для получения дополнительных знаний о дальнодействующих взаимодействиях.Мы ожидаем, что в сочетании с дальнейшими генетическими манипуляциями будущие исследования приведут к новому пониманию пространственной организации генома.

ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

Дополнительные данные доступны в NAR Online.

БЛАГОДАРНОСТИ

Мы хотели бы поблагодарить Х. Навида и Р. Вуэрффелла за ценные обсуждения и М. Маселлаио за чтение рукописи.

ФИНАНСИРОВАНИЕ

Национальные институты здравоохранения [R01GM126558 до J.L., R21AI126308 на J.L. и A.K., R01AI121286, R21AI117687 на A.K.]; Чикагский биомедицинский консорциум при поддержке Searle Funds в The Chicago Community Trust (A.K. и J.L.). Финансирование платы за открытый доступ: Фонд исследований открытого доступа (ROAAP) Иллинойского университета в Чикаго.

Заявление о конфликте интересов . Ничего не объявлено.

ССЫЛКИ

1.

Fraser

P.

,

Bickmore

W.

Ядерная организация генома и потенциал регуляции генов

.

Природа

.

2007

;

447

:

413

417

. 2.

Rippe

K.

,

Dekker

M.

,

Dekker

J.

,

Kleckner

N.

Получение конформации хромосом

.

Наука

.

2002

;

295

:

1306

1311

.3.

Hagège

H.

,

Klous

P.

,

Braem

C.

,

Splinter

E.

,

Dekker

J.

,

G. ,

de Laat

W.

,

Forné

T.

Количественный анализ анализов захвата конформации хромосом (3c-qpcr)

.

Nat. Protoc.

2007

;

2

:

1722

1733

.4.

Miele

A.

,

Bystricky

K.

,

Dekker

J.

Дрожжевые локусы молчащего типа спаривания образуют гетерохроматические кластеры посредством сайленсирующих белков-зависимых дальнодействующих взаимодействий

.

PLoS Genet.

2009

;

5

:

e1000478

. 5.

Либерман-Эйден

E.

,

van Berkum

N.L.

,

Вильямс

Л.

,

Имакаев

М.

,

Ragoczy

T.

,

Telling

A.

,

Amit

I.

,

Lajoie

B.R.

,

Sabo

P.J.

,

Dorschner

M.O.

et al.

Комплексное картирование дальнодействующих взаимодействий раскрывает принципы сворачивания генома человека

.

Наука

.

2009

;

326

:

289

293

.6.

Дуань

З.

,

Andronescu

M.

,

Schutz

K.

,

McIlwain

S.

,

Kim

YJ

,

Lee

C.

,

Shendure J. Поля

S.

,

Blau

CA

,

Благородный

W.S.

Трехмерная модель генома дрожжей

.

Природа

.

2010

;

465

:

363

367

.7.

Montefiori

L.

,

Wuerffel

R.

,

Roqueiro

D.

,

Lajoie

B.

,

Guo

C.

,

T. Geras ,

De

S.

,

Wood

W.

,

Becker

KG

,

Dekker

J.

et al.

Очень длинные петли хроматина связывают топологические домены, что способствует разнообразию репертуара антител

.

Cell Rep.

2015

;

14

:

896

906

.8.

Нора

E.P.

,

Lajoie

B.R.

,

Schulz

E.G.

,

Giorgetti

L.

,

Okamoto

I.

,

Servant

N.

,

Piolot

T.

,

van Berkum

N.L.

,

Meisig

J.

,

Sedat

J.

et al.

Пространственное разбиение регуляторного ландшафта центра x-инактивации

.

Природа

.

2012

;

485

:

381

385

.9.

Dixon

JR

,

Selvaraj

S.

,

Yue

F.

,

Kim

A.

,

Li

Y.

,

Shen

Hu

M.

,

Liu

J.S.

,

Ren

B.

Топологические домены в геномах млекопитающих, идентифицированные с помощью анализа взаимодействий хроматина

.

Природа

.

2012

;

485

:

376

380

.10.

Phillips-Cremins

J.E.

,

Sauria

M.E.

,

Sanyal

A.

,

Gerasimova

T.I.

,

Lajoie

B.R.

,

Белл

Дж.S.

,

Ong

C.T.

,

Hookway

T.A.

,

Guo

C.

,

Sun

Y.

et al.

Архитектурные подклассы белков формируют трехмерную организацию геномов во время фиксации клонов

.

Ячейка

.

2013

;

153

:

1281

1295

.11.

Чжан

Ю.

,

Дудко

О.К.

,

Лукас

Дж.S.

,

Murre

C.

Трехмерные траектории, принятые кодирующими и регуляторными элементами ДНК: время первого прохождения для геномных взаимодействий

.

Ячейка

.

2014

;

158

:

339

352

.12.

Ay

F.

,

Noble

W.S.

Методы анализа для изучения трехмерной архитектуры генома

.

Genome Biol.

2015

;

16

:

183

.13.

Junier

I.

,

Разлив

Y.G.

,

Marti-Renom

M.A.

,

Beato

M.

,

le Dily

F.

О демультиплексировании данных о конформации захвата хромосом

.

FEBS Lett.

2015

;

589

:

3005

3013

. 14.

Di Pierro

M.

,

Zhang

B.

,

Aiden

E.L.

,

Wolynes

P.G.

,

Онучич

J.N.

Переносимая модель хромосомной архитектуры

.

Proc. Natl. Акад. Sci. США

2016

;

113

:

12168

12173

.15.

Junier

I.

,

Dale

R.K.

,

Hou

C.

,

Kepes

F.

,

Dean

A.

CTCF-опосредованная регуляция транскрипции через клеточно-специфичную организацию хромосом в β-глобиновом локусе

.

Nucleic Acids Res.

2012

;

40

:

7718

7727

. 16.

Брэкли

C.A.

,

Johnson

J.

,

Kelly

S.

,

Cook

PR

,

Marenduzzo

D.

Имитация связывания факторов транскрипции с активными и неактивными областями, складывает человеческие хромосомы в петли. розетки и топологические домены

.

Nucleic Acids Res.

2016

;

44

:

3503

35012

. 17.

Jost

D.

,

Carrivain

P.

,

Cavalli

G.

,

Vaillant

C.

Моделирование сворачивания эпигенома: формирование и динамика топологически связанных доменов хроматина

.

Nucleic Acids Res.

2014

;

42

:

9553

9561

. 18.

Кьяриелло

А.M.

,

Annunziatella

C.

,

Bianco

S.

,

Esposito

A.

,

Nicodemi

M.

Полимерная физика хромосомной крупномасштабной трехмерной организации

.

Sci. Отчет

2016

;

6

:

29775

.19.

Giorgetti

L.

,

Galupa

R.

,

Nora

E.P.

,

Пиолот

т.

,

Lam

F.

,

Dekker

J.

,

Tiana

G.

,

Heard

E.

Прогнозирующее полимерное моделирование выявляет сопряженные колебания конформации хромосом 9000 и транскрипции.

Ячейка

.

2014

;

157

:

950

963

.20.

Tokuda

N.

,

Terada

T.P.

,

Сасаи

М.

Динамическое моделирование трехмерной организации генома в межфазных почкующихся дрожжах

.

Biophys J.

2012

;

102

:

296

304

. 21.

Barbieri

M.

,

Chotalia

M.

,

Fraser

J.

,

Lavitas

LM

,

Dostie

J.

,

Pom4bo A.

М.

Сложность сворачивания хроматина фиксируется переключателем струн и связок модели

.

PNAS

.

2012

;

109

:

16173

16178

. 22.

Kang

H.

,

Yoon

Y.

,

Thirumalai

D.

,

Hyeon

C.

Стекловидная динамика, индуцированная конфайнментом, в модели для хромосомной организации

.

Phys. Rev. Lett.

2015

;

115

:

198102

.23.

Голобородько

А.

,

Марко

J.F.

,

Мирный

L.A.

Уплотнение хромосом путем экструзии активной петли

.

Biophys. J.

2016

;

110

:

2162

2168

. 24.

Fudenberg

G.

,

Imakaev

M.

,

Lu

C.

,

Goloborodko

A.

,

Abdennur

N.

,

Мирный

Л.А.

Формирование хромосомных доменов путем выдавливания петель

.

Cell Rep.

2016

;

15

:

2038

2049

. 25.

Sanborn

A.L.

,

Rao

S.S.

,

Huang

S.C.

,

Durand

N.C.

,

Huntley

M.H.

,

Jewett

A.I.

,

Бочков

И.D.

,

Chinnappan

D.

,

Cutkosky

A.

,

Li

J.

et al.

Экструзия хроматина объясняет ключевые особенности образования петель и доменов в геномах дикого типа и сконструированных геномах

.

Proc. Natl. Акад. Sci. США

2015

;

12

:

E6456

E6465

. 26.

Zhang

B.

,

Wolynes

P.G.

Топология, структуры и энергетические ландшафты хромосом человека

.

PNAS

.

2015

;

112

:

6062

6067

. 27.

Tjong

H.

,

Gong

K.

,

Chen

L.

,

Alber

F.

Физическая привязка и исключение объема определяют организацию генома более высокого порядка у зарождающихся дрожжей

.

Genome Res.

2012

;

22

:

1295

1305

. 28.

Вонг

Х.

,

Marie-Nelly

H.

,

Herbert

S.

,

Carrivain

P.

,

Blanc

H.

,

Koszul

R.

, 9000 4 Fab4 E.

,

Zimmer

C.

Прогностическая вычислительная модель динамического трехмерного межфазного ядра дрожжей

.

Curr Biol.

2012

;

22

:

1881

1890

. 29.

Baù

D.

,

Sanyal

A.

,

Lajoie

B.R.

,

Capriotti

E.

,

Byron

M.

,

Lawrence

JB

,

Dekker

J.

,

Marti-Renom

MA

9000 -9

трехмерное складывание Домен гена α-глобина обнаруживает образование глобул хроматина

.

Nat. Struct. Мол. Биол.

2010

;

18

:

107

114

.30.

Fraser

J.

,

Ferraiuolo

MA

,

Dostie

J.

,

Blanchette

M.

,

Rousseau

Трехмерное моделирование

M.

размерной структуры хроматина из данных частоты взаимодействия с использованием выборки методом Монте-Карло цепи Маркова

.

BMC Bioinformatics

.

2011

;

12

:

414

. 31.

Kalhor

R.

,

Tjong

H.

,

Jayathilaka

N.

,

Alber

F.

,

Chen

L.

Архитектура генома, выявленная с помощью привязанного захвата конформации хромосомы и популяционного моделирования

.

Nat. Biotechnol.

2011

;

30

:

90

98

.32.

Meluzzi

D.

,

Arya

G.

Восстановление ансамблей конформаций хроматина по вероятностям контакта

.

Nucleic Acids Res.

2013

;

41

:

63

75

. 33.

Ay

F.

,

Bunnik

E.M.

,

Varoquaux

N.

,

Bol

S.M.

,

Prudhomme

J.

,

Vert

J.P.

,

Noble

W.S.

,

Le Roch

K.G.

Трехмерное моделирование генома P. Falciparum во время эритроцитарного цикла показывает сильную связь между архитектурой генома и экспрессией генов

.

Genome Res.

2014

;

24

:

974

988

. 34.

Trieu

T.

,

Cheng

J.

Масштабная реконструкция трехмерных структур хромосом человека на основе хромосомных контактных данных

.

Nucleic Acids Res.

2014

;

42

:

e52

.35.

Wang

S.

,

Xu

J.

,

Zeng

J.

Инференциальное моделирование трехмерной структуры хроматина

.

Nucleic Acids Res.

2015

;

43

:

e54

,36.

Tjong

H.

,

Li

W.

,

Kalhor

R.

,

Dai

C.

,

Hao

S.

,

Gong

K. Чжоу

Y.

,

Li

H.

,

Zhou

X.J.

,

Le Gros

M.A.

et al.

Популяционный анализ трехмерной структуры генома выявляет движущие силы в пространственной организации генома

.

PNAS

.

2016

;

113

:

E1663

E1672

.37.

Белмонт

A.S.

Крупномасштабная организация хроматина: хорошее, удивительное и все еще вызывающее недоумение

.

Curr. Opin. Cell Biol.

2014

;

26

:

69

78

.38.

Li

G.

,

Ruan

X.

,

Auerbach

R.K.

,

Sandhu

К.С.

,

Zheng

M.

,

Wang

P.

,

Poh

H.M.

,

Goh

Y.

,

Lim

J.

,

Zhang

J.

et al.

Обширные промотор-центрированные взаимодействия хроматина обеспечивают топологическую основу для регуляции транскрипции

.

Ячейка

.

2012

;

148

:

84

98

. 39.

Heidari

N.

,

Phanstiel

DH

,

He

C.

,

Grubert

F.

,

Jahanbani

F.

,

Kasowski

000 Kasowski

кв.м

,

Снайдер

М.П.

Полногеномная карта регуляторных взаимодействий в геноме человека

.

Genome Res.

2014

;

24

:

1095

1917

.40.

Gürsoy

G.

,

Xu

Y.

,

Kenter

AL

,

Liang

J.

Пространственное ограничение является основным детерминантом программирования складчатости человеческих хромосом.

.

Nucleic Acids Res.

2014

;

42

:

8223

8230

.41.

Boettiger

A.N.

,

Bintu

B.

,

Moffitt

JR

,

Wang

S.

,

Beliveau

BJ

,

Fudenberg

G.

LA

,

Wu

CT

,

Zhuang

X.

Визуализация со сверхвысоким разрешением показывает отчетливую укладку хроматина для разных эпигенетических состояний

.

Природа

.

2016

;

529

:

418

422

.42.

Наумова

N.

,

Smith

E.M.

,

Zhan

Y.

,

Dekker

J.

Анализ дальнодействующих взаимодействий хроматина с использованием определения конформации хромосом

.

Методы

.

2012

;

58

:

192

203

. 43.

Йоав

Б.

,

Hochberg

Y.

Контроль ложного обнаружения: практичный и эффективный подход к множественному тестированию

.

J. R. Stat. Soc.

1995

;

57

:

289

300

. 44.

Liang

J.

,

Zhang

J.

,

Chen

R.

Статистическая геометрия дефектов упаковки полимера с цепной решеткой из подсчета и последовательного метода Монте-Карло

.

J. Chem. Phys.

2002

;

117

:

3511

3521

. 45.

Zhang

J.

,

Chen

R.

,

Tang

C.

,

Liang

J. Полимеры с длинной цепью

.

J. Chem. Phys.

2003

;

118

:

6102

. 46.

Лин

М.

,

Лю

Х.М.

,

Chen

R.

,

Liang

J.

Создание правильно взвешенного ансамбля конформаций белков из редких или косвенных ограничений расстояния

.

J. Chem. Phys.

2008

;

129

:

0

.47.

Lin

M.

,

Chen

R.

,

Liang

J.

Статистическая геометрия решетчатых цепных полимеров с пустотами определенной формы: выборка с сильными ограничениями

.

J. Chem. Phys.

2008

;

128

:

084903

. 48.

Zhang

J.

,

Dundas

J.

,

Lin

M.

,

Chen

R.

,

Wang

W.

,

Liang

J. Прогнозирование геометрически возможных трехмерных структур псевдоузловой РНК посредством оценки свободной энергии

.

РНК

.

2009

;

15

:

2248

2263

.49.

Cao

Y.

,

Liang

J.

Адаптивно смещенная последовательная выборка важности для редких событий в реакционных сетях со сравнением с точными решениями из метода dCME с конечным буфером

.

J. Chem. Phys.

2013

;

139

:

025101

.50.

Lin

M.

,

Chen

R.

,

Liu

J.S.

Опережающие стратегии для последовательного Монте-Карло

.

Stat. Sci.

2013

;

28

:

69

94

. 51.

Zhou

G.L.

,

Xin

L.

,

Song

W.

,

Di

L.J.

,

Liu

G.

,

Wu

X

X

,

Лю

Д.П.

,

Лян

C.C.

Активный хроматиновый хаб альфа-глобинового локуса мыши образуется в фабрике транскрипции кластерных генов домашнего хозяйства

.

Мол. Клетка. Биол.

2006

;

26

:

5096

5105

. 52.

Vernimmen

D.

,

Marques-Kranc

F.

,

Sharpe

J.A.

,

Sloane-Stanley

J.A.

,

Вуд

W.G.

,

Wallace

H.A.

,

Смит

А.Дж.

,

Хиггс

D.R.

Хромосомная петля в локусе α-глобина человека опосредуется через главный регуляторный элемент, расположенный выше (hs-40)

.

Кровь

.

2009

;

114

:

4253

4260

. 53.

Zeng

C.

,

Guo

X.

,

Long

J.

,

Kuchenbaecker

K.B.

,

Droit

A.

,

Michailidou

K.

,

Ghoussaini

M.

,

Kar

S.

,

Freeman

A.

,

Hopper J.L.

et al.

Интегрированная энциклопедия элементов ДНК в геноме человека

.

Природа

.

2012

;

489

:

57

74

. 54.

Сложный эфир

M.

,

Kriegel

H.P.

,

Sander

J.

,

Xu

X.

Алгоритм на основе плотности для обнаружения кластеров в больших пространственных базах данных с шумом

.

Труды 2-й Международной конференции по открытию знаний и интеллектуальному анализу данных

.

1996

;

226

231

.55.

Doyle

B.

,

Fudenberg

G.

,

Imakaev

M.

,

Mirny

L.A.

Хроматиновые петли как аллостерические модуляторы взаимодействий энхансер-промотор

.

PLoS Comput. Биол.

2014

;

10

:

1003867

. 56.

Шалек

А.К.

,

Сатия

р.

,

Шуга

J.

,

Trombetta

J.J.

,

Gennert

D.

,

Lu

D.

,

Chen

P.

,

Gertner

R.S.

,

Gaublomme

J.T.

,

Yosef

N.

et al.

Single-cell RNA-seq показывает динамический паракринный контроль клеточных вариаций

.

Природа

.

2014

;

510

:

363

369

.57.

Шалек

А.К.

,

Satija

R.

,

Adiconis

X.

,

Gertner

R.S.

,

Gaublomme

J.T.

,

Raychowdhury

R.

,

Schwartz

S.

,

Yosef

N.

,

Malboeuf

C.

,

Lu

D.

et al.

Одноклеточная транскриптомика выявляет бимодальность экспрессии и сплайсинга в иммунных клетках

.

Природа

.

2013

;

498

:

236

240

. 58.

Rotem

A.

,

Ram

O.

,

Shoresh

N.

,

Sperling

R.A.

,

Goren

A.

,

Weitz

D.A.

,

Bernstein

B.E.

Одноклеточная ChIP-seq выявляет субпопуляции клеток, определяемые состоянием хроматина

.

Nat.Biotechnol.

2015

;

33

:

1165

1172

. 59.

Fraser

P.

Транскрипционный контроль, брошенный для цикла

.

Curr. Opin. Genet. Dev.

2006

;

16

:

490

495

.60.

Rao

S.S.

,

Huntley

M.H.

,

Durand

N.C.

,

Stamenova

E.K.

,

Бочков

И.Д.

,

Робинсон

Дж. Т.

,

Sanborn

A.L.

,

Machol

I.

,

Omer

AD

,

Lander

E.S.

et al.

Трехмерная карта генома человека с разрешением в килобазы показывает принципы образования петель хроматина

.

Ячейка

.

2014

;

159

:

1665

1680

.

Заметки автора

© Автор (ы) 2017.Опубликовано Oxford University Press от имени Nucleic Acids Research.

.

Похожие записи

Вам будет интересно

Бизнес по сбору металлолома: Как я сдавал металлолом и придумал бизнес на 1 млрд — Трибуна на vc.ru

Реестр электронных больничных листов – ФСС — Электронный листок нетрудоспособности

Добавить комментарий

Комментарий добавить легко