Метод 5с: Система 5 с бережливое производство или стандарты рабочего места

Содержание

В помощь учителю: метод 5С для воспитания успешных учеников | Большая перемен@

Как учителя мы не только даем знания, но и формируем личность ребенка. Конечно, ответственность за воспитание лежит на родителях, но к подростковому возрасту их авторитет тает на глазах. В этот период любимый преподаватель может стать наставником и опорой для взрослеющих учеников.

В работе с подростками учителю поможет метод 5С. Что это за метод и как его можно применить на уроках, рассказываем в статье.

В чем суть

Метод подробно описала журналист и преподаватель Эстер Войджицки: она использовала его в работе со студентами и воспитании детей.

Повзрослев, все три дочери Эстер построили успешную карьеру: Сьюзен стала генеральным директором YouTube, Энн — основательницей инновационной компании генетического тестирования, Джанет — антропологом и исследователем.

5С основывается на пяти принципах: самодоверие, самоуважение, самостоятельность, сотрудничество, сердечность.

Самодоверие

Прислушивайтесь к внутреннему голосу, доверяйте себе и ученикам. Если интуиция шепчет отступить от плана урока или тайминга собрания, чтобы больше времени уделить практике или обсудить тему, которая нашла отклик у школьников, — сделайте это.

Живая реакция на внезапные потребности принесет больше пользы, чем строгое следование плану.

Самоуважение

Без уважения к личности не получится найти общий язык: подростки остро реагируют, когда их пытаются насильно изменить. Примите учеников такими, какие они есть: с особенностями характера, интересами, манерой поведения. Если вы чем-то недовольны, то критикуйте действия, а не личность.

Когда ученики видят, что в них верят и не хотят унизить, то они и сами для себя ставят высокие планки.

Уважать друг друга — тоже важно. Терпимости научит парная и групповая работа учеников с разными взглядами на жизнь и разным уровнем знаний, а об ответственности напомнит разговор о правах и обязанностях.

Самостоятельность

Вы наверняка замечали, что гиперопека только вредит воспитанию: ребенок, которого постоянно оберегали от всего на свете, боится принимать решения и нести за них ответственность.

Разговаривайте с учениками на необычные темы (о путешествиях, популярных сериалах, мировых событиях), расширяйте их кругозор и приглашайте к дискуссии. Дайте им больше свободы. Например, разрешите выбрать темы внеклассных занятий, самим подготовить праздник, придумать задания для теста или образовательных игр (читайте наш материал «Игры для урока с нестандартными правилами»).

Сотрудничество

Дайте понять ученикам, что вы одна команда. Не сравнивайте между собой подростков — это их разобщит.

Покажите, что можно получить, работая сообща: поощряйте ситуации, когда подростки учатся друг у друга.

Чаще используйте групповую работу и не забывайте менять составы групп, чтобы ученики общались не только с друзьями. Несколько простых игр и упражнений помогут школьникам научиться доверять друг другу и лучше взаимодействовать.

Сердечность

Доброта — ключ к сердцам учеников. Без эмпатии не будет доверия, уважения, сотрудничества, веры в себя и в других.

Быть добрым не значит закрывать глаза на дисциплину. Обговорите с учениками правила поведения на уроке, наказание за проступки. Можно составить и подписать «классный договор». Благодарите школьников и подсказывайте, когда нужно поблагодарить учителей и одноклассников.

Дружелюбная атмосфера даст сильный толчок развитию учеников, а там и до первых больших успехов рукой подать.

А как вы считаете, должна ли школа воспитывать учеников или это обязанность только родителей? Напишите в комментариях свое мнение.

Конспект урока Метод 5С в Бережливом производстве

Метод 5С

Цель урока:

·                   Получить представления о методе 5С

Задачи урока:

·                   Знать в чем преимущество использования метода 5С

·                   Ознакомиться с ГОСТ Р 56407-2015 Бережливое производство. Основные методы и инструменты

 

Под инструментом бережливого производства понимается средство осуществления действий, направленных на решение определенных задач или достижение определенных целей.

Под методом бережливого производства понимается систематизированная совокупность шагов, которые необходимо предпринять, чтобы решить определенную задачу.

Метод Бережливого производства 5С является базовым инструментом. Его внедрение и применение способствует созданию условий для эффективного выполнения операций, экономии времени, повышения производительности, а также созданию и поддержанию чистоты и порядка на рабочем месте.

Название метода обозначает совершение 5 действий, каждое из которых начинается с буквы «С»: сортировка, самоорганизация, систематическая уборка, стандартизация и совершенствование.

Этапы применения:

1.     Сортировка (удаление ненужных предметов) – задача удалить с рабочего места все предметы, которые не нужны для текущей деятельности и не создающие ценность продукта. Можно использовать метод цветных ярлыков.

·        Определение перечня необходимых предметов. Можно пометить синими ярлыками

·        Сортировка предметов на нужные и не нужные. Можно пометить красными ярлыками.

·        Избавление от не нужных предметов.

 

Пример 1 этапа

 

Степень использования

Место хранения

Использование не планируется

Списать, уничтожить

Используется 1 раз в год или реже

Переместить на склад на территории предприятия

Используется 1 раз в 6 месяцев

Переместить на склад на территории цеха

Используется 1 раз в неделю

Переместить на склад на производственном участке

Используется ежедневно

Оставить на рабочем месте

 

2.      Самоорганизация (соблюдение порядка) – задача – расположить предметы на рабочем месте так, чтобы любой сотрудник мог найти то, что ему нужно без дополнительной помощи. Можно использовать способ маркировки однотипных деталей, предметов.

 

·        Определить место хранения для каждого предмета.

·        Расположить предметы исходя из частоты их использования.

·        Визуализировать место хранения.

·        Провести маркировку

 

3.     Систематическая уборка (содержание в чистоте) – задача – содержать рабочее место в чистоте.

 

·        Определить источники загрязнения

·        Определить правила уборки

·        Определить график уборки и ответственных за неё

·        Проводить уборку по установленным правилам

·        Осуществлять контроль за уборкой

 

4.     Стандартизация – задача – соблюдать аккуратность за счет регулярного использования первых трех «С».

 

·        Создать стандарты содержания рабочих мест исходя из полученных ранее результатов.

5.     Совершенствование (поддержание и улучшение ) – задача – превращение ранее установленных правил и процедур в постоянную привычку.

·        Соблюдать стандарты содержания каждого рабочего места

·        Постоянно совершенствовать организацию рабочего пространства.

 

Возможности и риски использования метода 5С

·        Улучшение условий труда, проявление инициативы и творческого потенциала работников, сокращение потерь, повышение степени вовлеченности работников в процессы улучшения рабочего пространства.

·        Возвращение к первоначальному состоянию рабочего пространства, есл метод не используется постоянно.

 

 

Вопросы и задания:

1.     Вы решили использовать метод 5С на своем рабочем месте, но необходимо убедить в эффективности его использования своего напарника. Как вы будете это делать?

2.     Задача усложняется: Ваш напарник старше по возрасту и имеет более долгий опыт работы на данной должности. Как вы будете это делать?

Система 5С. Организация рабочего места

1. СИСТЕМА 5С

Семинар
Сентябрь, 2018
производительность.рф
производительность.рф

2. В ходе обучения вы узнаете

Как влияет 5С на качество,
безопасность и производительность
Лучшие практики
применения 5С на
производстве
Как устранить
потери и проблемы
за счет системы 5С
Шаги 5С
производительность.рф
Что такое система 5С
и зачем она нужна?
2
Что такое система 5С?
01
Cистема безопасной и эффективной
организации рабочего места
Простые принципы для
получения максимальной
выгоды из имеющихся ресурсов
03
производительность.рф
02
Отправная точка построения
производственной системы для
предприятия
3
5 простых шагов
1. СОРТИРУЙТЕ
2. СОБЛЮДАЙТЕ ПОРЯДОК
3. СОДЕРЖИТЕ В ЧИСТОТЕ
4. СТАНДАРТИЗИРУЙТЕ
5. СОВЕРШЕНСТВУЙТЕ
производительность.рф
4

5. Мифы о системе 5С

5с не влияет на
производительность
5С – это
только для
красоты!
5С – это
«генеральная
уборка»
А какие мифы о 5С знаете вы?
производительность.рф
5

6. Почему появились эти мифы?

«Оконтуривание мыши»
и прочее бездумное
применение 5С
производительность.рф
6

7. Обсуждение

Как вы считаете, это
рабочее место:
• красивое?
• удобное?
• рационально
организованное?
производительность.рф
7

8. Обсуждение

Как вы считаете, это
размещение
инструмента:
• красивое?
• удобное?
• рационально
организованное?
производительность.рф
8

9. Обсуждение

Как вы считаете, это
рабочее место:
• красивое?
• удобное?
• рационально
организованное?
производительность. рф
9

10. Из чего состоит 5С?

Содержите в чистоте
Соблюдайте порядок
Определите:
• наименование
• количество
• место расположения
• цветовую маркировку
• маршрут
Сортируйте
• оставьте только
нужное
• избавьтесь от
ненужного
производительность.рф

Содержите и оставляйте рабочее место в
чистоте, в исправном, подготовленном к
работе состоянии
Стандартизируйте



Стандартизируйте
процедуры
поддержания порядка.

Совершенствуйте
порядок,
стимулируйте его
поддержание
10

11. ОРГАНИЗАЦИЯ РАБОЧЕГО МЕСТА

Упражнение
ОРГАНИЗАЦИЯ РАБОЧЕГО МЕСТА
производительность.рф
11
Шаг 1: сортируйте
• Отдели необходимое от
бесполезного
• Обозначь редко используемое
• Оставь только нужное
оставить на
рабочем
месте?
НУЖНО
ПОСТОЯННО
• ежечасно
• ежедневно
• раз в неделю
НЕ НУЖНО
СРОЧНО
• реже 1 раза в неделю
• по мере надобности
• под редкий заказ
НЕ НУЖНО
ВООБЩЕ
производительность. рф
• не использую
более 3-х месяцев
• не использую в
техпроцессе
12
Примеры рабочих пространств
ДО сортировки
Невозможно найти что-либо быстро, оценить, что есть в наличии
производительность.рф
13
Примеры рабочих пространств
ДО сортировки
Рабочая поверхность должна быть
свободная
производительность.рф
Рабочее пространство – для работы
14
Сортировка: до и после (1)
Цель сортировки: эффективное использование
рабочего пространства
производительность.рф
15
Сортировка: до и после (2)
Цель сортировки: эффективное использование
рабочего пространства
производительность.рф
16
Это не про нас?
Вставьте свои фото
предприятия
производительность.рф
Вставьте свои фото
предприятия
17
Это не про нас?
Вставьте свои фото
предприятия
производительность.рф
Вставьте свои фото
предприятия
18
Что делать с «ненужным»?
сломанные
предметы
осталось после
вспомогательных
служб
Неиспользуемые
С истекшим
сроком службы
МУСОР
производительность. рф
Назначение
непонятно
ЗОНА КАРАНТИНА
19
Правила зоны карантина
1
2
3
все предметы в зоне карантина должны
быть помечены красными ярлыками
специалисты подразделений
должны принять решение о
необходимости дальнейшего
использования этих предметов
если предмет невозможно
перенести в зону карантина повесить красные ярлыки по
месту нахождения.
производительность.рф
20
Оформление красных ярлыков
!
• Зона карантина ≠ Склад
• Для каждого предмета определена дата, когда
он должен быть удален из зоны карантина
производительность.рф
21
Шаг 2: соблюдайте порядок
Какие проблемы решает?
Долгий поиск, потеря
времени
Утеря, просрочена работа,
документации/информации
Закончились расходные
материалы, не привезены
вовремя
производительность.рф
22
Правильная организация
Не более 30 секунд на У каждого предмета есть
Быстро и легко
поиск любого
свой адрес. Предмет
достать; можно
инструмента,
невозможно положить свободно перемещать
документа или
не туда или не так
Доступ в 1 касание
предмета любым
сотрудником
производительность.рф
23
Примеры организации (1)
Использование цветовой
маркировки
и защиты от ошибки
производительность.рф
Метод теней эффективнее
использовать на
вертикальных поверхностях
24
Примеры организации (2)
Ключ невозможно
положить не на свое место
производительность.рф
Использование цветовой
маркировки
25
Примеры организации (3)
Метод трафаретов – для
горизонтальных
поверхностей
производительность.рф
Наименование размера и
цветовой сигнал о
дозаказе
26
Метод трафаретов
Контрастный фон позволяет быстро определить
отсутствующий инструмент
производительность.рф
27
Организация «до» и «после»
производительность.рф
28
Организация: лучшие практики
Участок станков с ЧПУ в
цехе 354
производительность. рф
Слесарный участок у
станка Hermle в цехе 354
Зона станка ГРС в цехе
355
29
Защита от ошибок
и обнаружение проблем
• Болты с большим диаметром не
ложатся в ячейку для хранения болтов
с маленьким диаметром
• При деформации рым болта он не
установится в место хранения и, таким
образом, проблема будет обнаружена
Зона погрузочноразгрузочных работ цеха
354
производительность.рф
30
Удобство поиска
Шкаф для хранения инструмента
производительность.рф
31
А как у нас?
Вставьте свои фото рабочих
мест, где требуется
организовать хранение
инструмента/оснастки/
документов
производительность.рф
Вставьте свои фото рабочих
мест, где требуется
организовать хранение
инструмента/оснастки/
документов
32
А как у нас?
Вставьте свои фото рабочих
мест, где требуется
организовать хранение
инструмента/оснастки/
документов
производительность. рф
Вставьте свои фото рабочих
мест, где требуется
организовать хранение
инструмента/оснастки/
документов
33
Шаг 3: содержите в чистоте
Какие проблемы решает?
Производственный брак:
попадание в продукцию
пыли, смазки и пр.
Долгое время обнаружения
неисправностей
оборудования
Травмы
производительность.рф
34
Объекты проверки при уборке
ОБОРУДОВАНИЕ
нет пыли, грязи, подтеков масла, стружки, отходов
производства, поврежденных элементов (рам, корпусов),
плавное вращение и пр.
ВСПОМОГАТЕЛЬНОЕ
ОБОРУДОВАНИЕ
тех. оснастка, мерительный и режущий инструмент.
РАБОЧАЯ ЗОНА
ЗОНА ОБСЛУЖИВАНИЯ
нет предметов других технологических процессов,
стружки, отходов производства, целостность систем
автоматики, гидравлики, пневмосистем и
электроснабжения.
ЗАЩИТНЫЕ ОГРАЖДЕНИЯ
Наличие и исправность ограждений, отсутствие повреждений
стопорных и предохранительных элементов.
производительность.рф
35
Труднодоступные места
• устранить труднодоступное место;
• сделать место легкодоступным;
• использовать специальные
приспособления для уборки
производительность.рф
36
Источники загрязнения
Локализация
• уменьшение интенсивности
загрязнения
• сокращение зоны загрязнения
• повышение эффективности
чистки/уборки
Ликвидация
Стремиться ликвидировать
источники загрязнений
производительность.рф
37
3С в действии (1)
Поиск труднодоступных
и сложных мест
производительность.рф
Поиск источников
загрязнений
38
3С в действии (2)
Поиск опасных факторов
производительность.рф
Поиск неисправностей
39
3С в действии (3)
Принятие мер по труднодоступным местам
Поднятые кабели
облегчают мытье пола
производительность.рф
Заглушки на пазах
фрезерного станка
облегчают чистку
Шаг 4: стандартизируйте
Какие проблемы решает?
«Откат» к предыдущему
состоянию
Невозможность оценить
наличие и достаточное
количество инструмента/
комплектующих/
расходников
производительность. рф
41
Визуальные стандарты
Место парковки автокара
выделено цветом, нанесена
пиктограмма
производительность.рф
Выработанный порядок
зафиксирован визуально;
обозначены места,
требующие особого
внимания
42
Обозначения мест хранения
Места хранения инструмента/ инвентаря
дополнительно подписаны
производительность.рф
43
Визуальный стандарт перемещения
Обозначены безопасные маршруты перемещения
производительность.рф
44
Стандарт уборки
Стандарт уборки
помещения
производительность.рф
Визуальная инструкция
45
Визуализация правил и стандартов
Обозначены места,
требующие внимания
46
производительность.рф
Указано количество
бочек для начала
следующей операции
Стандарт хранения
Фотография как
визуальный
стандарт
производительность.рф
Использование карточек с
«адресом» инструмента в
данный момент
47
Есть ли у нас стандартизация?
Вставьте фото своего
предприятия для
иллюстрации
наличия/отсутствия
визуального стандарта
производительность. рф
Вставьте фото своего
предприятия для
иллюстрации
наличия/отсутствия
визуального стандарта
48
А как у нас?
Вставьте фото своего
предприятия для
иллюстрации
наличия/отсутствия
визуального стандарта
производительность.рф
Вставьте фото своего
предприятия для
иллюстрации
наличия/отсутствия
визуального стандарта
49
Шаг 5: совершенствуйте


СОРТИРУЙТЕ
СОБЛЮДАЙТЕ
ПОРЯДОК

СОВЕРШЕНСТВУЙТЕ


СТАНДАРТИЗИРУЙТЕ
СОДЕРЖИТЕ В
ЧИСТОТЕ
производительность.рф
Следовать правилам,
совершенствовать правила
• проверять соблюдение
стандартов;
• соблюдать дисциплину и
ежедневно применять
принципы 5С;
• обучать коллег;
• улучшать разработанные
стандарты
50
Влияние 5С на безопасность,
качество и производительность
БЕЗОПАСНОСТЬ
производительность.рф
КАЧЕСТВО
ПРОИЗВОДИТЕЛЬНОСТЬ
51
Вывод: что дает 5с предприятию?
Безопасность
СТАБИЛЬНОСТЬ
Качество
производительность. рф
Производительность
52

Бережливое производство | » Система 5S

Как то Генри Форд сказал: «бедность происходит от перетаскивания мертвых грузов».

Мертвые грузы – это не только ненужные, бесполезные вещи, транспортировка и хранение которых обходится значительно дороже их самих, но и стереотипы любой природы: и мысли, и взгляды, и технологии, время которых прошло, и человеческие связи, себя, к сожалению и не по нашей вине, исчерпавшие.

Нужно стремиться, всячески избавляться от мертвых грузов. Одним из инструментов, помогающих в этом, является Система 5S.

Система 5S представляет собой метод упорядочения рабочего места, который значительно повышает эффективность и управляемость любого процесса, функционирования цеха, отдела, службы, склада, повышает безопасность работы, улучшает производственную культуру, укрепляет трудовую дисциплину, и сохраняет время.

Система 5S обычно используется как первый этап построения бережливого производства и внедрения инструментов Производственной Системы (стандартизации рабочих мест, визуального контроля, автономного обслуживания оборудования, переналадки и т. п.). Она помогает быстро избавиться от хлама, накопившегося на производстве, в отделах, складах, лабораториях, и исключить его появление в дальнейшем.

Название происходит от японских терминов, начинающих на «S», и в переводе обозначает последовательные шаги внедрения системы на рабочем месте:

Шаг 1. Сортировка, четкое разделение на нужное и ненужное, избавление от ненужного. Критерий – частота применения предмета на рабочем месте.

Шаг 2. Соблюдение порядка: определите для каждого предмета своё легкодоступное место, чтобы любой человек смог найти нужное.

Шаг 3. Содержание рабочего места в чистоте. Своевременная и постоянная уборка.

Шаг 4. Стандартизация процедуры поддержания чистоты и порядка.

Шаг 5. Совершенствование порядка, воспитание привычки всегда точно выполнять установленные правила, стимулирование тех, кто выполняет установленные требования.

Но сама по себе чистота и порядок не дают какой-либо результативности, так в чем же собственно говоря заключается эффект применения системы 5S? Если мы глубоко задумываемся над этим вопросом то поймем, что эффект долго себя не заставит ждать и проявится в:

  • снижение товарно-материальных запасов,
  • эффективном использование пространства,
  • исключение потерь вещей,
  • исключение утечек масла и воздуха,
  • исключение потерь времени, которые связаны с поиском нужного,
  • исключение небезопасного состояния,
  • поддержание и повышение эксплуатационных качеств оборудования,
  • улучшение атмосферы на рабочем месте,
  • исключение причин возникновения пожаров,
  • сокращение невнимательности,
  • улучшение человеческих взаимоотношений и т. д.

Принцип 5S заключается в «соблюдение правил, установленных всеми сотрудниками». Однако во многих случаях границы таких правил достаточно четко не определены. Для соблюдения установленных правил необходимо четко установить их границы, а также создать механизмы и инструменты их исполнения.

Данная система позволяет, практически без капитальных затрат, не только наводить порядок на производстве – повышать производительность, сокращать потери, снижать уровень брака и травматизма, но и создавать необходимые стартовые условия для реализации сложных и дорогостоящих производственных и организационных инноваций, обеспечивать их высокую эффективность — в первую очередь за счет радикального изменения сознания работников, их отношения к своему делу, при этом данная система не требует каких-либо серьезных затрат.

Массивно-параллельное решение для картирования взаимодействий между геномными элементами

Abstract

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть идентифицированы с помощью методологии захвата конформации хромосом (3C). 3C превращает физические взаимодействия хроматина в специфические продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микрочипы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения.Мы применили 5C для анализа области размером 400 т.п.н., содержащей локус β-глобина человека, и области пустыни консервативного гена размером 100 т.п.н. Мы подтвердили 5C, обнаружив несколько ранее идентифицированных петлевых взаимодействий в локусе β-глобина. Мы также идентифицировали новое петлеобразное взаимодействие в клетках K562 между областью контроля локуса β-глобина и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетических переключений глобиновых генов. 5C должен быть широко применим для крупномасштабного картирования цис-— и транс-— взаимодействующих сетей геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются интенсивные усилия по картированию генов и регуляторных элементов по всему геному человека (Консорциум проекта ENCODE, 2004 г.). Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ всего 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http://genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно картировать все гены и функциональные элементы, а также определить все взаимосвязи между ними. Например, должны быть идентифицированы все регуляторные элементы каждого гена. Эта попытка осложняется тем, что геномное положение генов и элементов не дает прямой информации о функциональных отношениях между ними. Хорошо известным примером являются энхансеры, которые могут регулировать несколько генов-мишеней, расположенных на больших геномных расстояниях или даже в разных хромосомах, не затрагивая гены, находящиеся непосредственно рядом с ними (Spilianakis et al. 2005 г.; Уэст и Фрейзер, 2005).

Недавние данные указывают на то, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямом физическом взаимодействии со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения указывают на то, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Следовательно, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами могут быть обнаружены с помощью метода захвата хромосомной конформации (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует перекрестное связывание формальдегида для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Взаимодействующие элементы затем расщепляются рестрикционными ферментами и внутримолекулярно лигируются. Частота лигирования двух рестрикционных фрагментов является мерой частоты их взаимодействия в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотека 3C создается с помощью обычного 3C, а затем преобразуется в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в условиях мультиплексирования. Затем библиотеки 5C анализируют на микрочипе или с помощью количественного секвенирования. ( B ) Дизайн грунтовки 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-концевой хвост, содержащий промоторную последовательность Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину сайта рестрикции. Все обратные праймеры содержат общий 3′-концевой хвост с комплементарной последовательностью Т3 (Т3с) и фосфорилированы на 5′-конце. Прямой и обратный праймеры 5C отжигают с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации хромосомы III дрожжей (Dekker et al. 2002), а затем применялся для анализа нескольких локусов млекопитающих, таких как локус β-глобина (Tolhuis et al.2002 г.; Палстра и др. 2003 г.; Вакок и др. 2005), локус цитокинов Т-хелперов 2 типа (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом связывающая ДНК закручивается наружу. 3С также использовали для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально родственными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005 г.; Линг и др. 2006 г.; Сюй и др. 2006). В совокупности эти исследования показывают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для выявления индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение с помощью ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микрочипы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует сильно мультиплексированную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или количественным секвенированием ДНК.

5C был разработан и подтвержден путем анализа локуса β-глобина человека и консервативной области генной пустыни, расположенной на хромосоме 16 человека. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий с образованием петель ДНК. Интересно, что анализ 5C также выявил петлеобразное взаимодействие между β-globin Locus Control Region (LCR) и межгенной областью γ-δ. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в фетальных клетках на экспрессию β-глобина во взрослых клетках (Calzolari et al.1999 г.; Грибнау и др. 2000).

5C должен широко применяться для определения связности цис и транс регуляторных элементов в больших геномных регионах. Кроме того, эксперименты 5C могут быть спланированы таким образом, чтобы можно было создавать полные карты взаимодействия для любой крупной интересующей области генома, которые могут выявить расположение новых регуляторных элементов генов, а также могут дать подробное представление о складках хромосом более высокого порядка.

Результаты

Метод 3C подробно описан (Dekker et al.2002 г.; Сплинтер и др. 2004 г.; Вакок и др. 2005 г.; Деккер 2006; Миле и др. 2006) и проиллюстрировано в . Эксперимент 3C создает сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие в геноме. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C отдельные частоты взаимодействия определяются путем количественного определения образования предполагаемых продуктов лигирования «голова к голове» с использованием полуколичественной ПЦР ().В качестве контроля ПЦР используют библиотеку, содержащую все продукты лигирования в эквимолярных количествах. Контрольная библиотека создается путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с контрольной библиотекой.

Описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al., 1988; Li et al., 2005; Peck et al., 2006). Лигировать можно только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы, основанные на LMA, являются количественными и могут выполняться при высоком уровне мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al. 2004 г.; Бибикова и др. 2005 г.; Харденбол и др. 2005 г.; Ван и др. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают с библиотекой 3C и лигируют. Используются два типа 5С-праймеров: 5С-прямой и 5С-обратный праймеры. Эти праймеры сконструированы таким образом, что прямые и обратные праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (12). Праймеры 5C, которые отжигают рядом друг с другом, затем лигируют лигазой Taq.На этом этапе создается библиотека 5C, которая амплифицируется универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируются только в том случае, если оба отжигаются с определенным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C генерируются и как часто. В результате библиотека 5С является количественной «копией» части библиотеки 3С, определенной по набору праймеров 5С.

Прямые и обратные праймеры 5C содержат уникальную последовательность, соответствующую смысловой и антисмысловой цепям 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. в дополнительных материалах).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Чтобы проанализировать взаимодействия между многими рестрикционными фрагментами, несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, в данном эксперименте с 5C можно использовать только один праймер на фрагмент, либо прямой, либо обратный. Для облегчения лигирования все обратные праймеры фосфорилированы на 5′-концах.Эта конструкция праймера 5C позволяет одновременно амплифицировать все потенциальные взаимодействия между всеми рестрикционными фрагментами, распознаваемыми прямым праймером, и всеми рестрикционными фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в локусе β-глобина человека

Мы разработали и оптимизировали подход 5C путем анализа локуса β-глобина человека. Этот локус был выбран потому, что ранее было обнаружено несколько петлевых взаимодействий с помощью 3C, а также второго метода, RNA-TRAP (Carter et al.2002 г.; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с помощью 5C можно использовать для проверки нового метода.

Локус β-глобина человека состоит из пяти регулируемых в процессе развития β-глобин-подобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, 0 HBB ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную выше кластера генов (). LCR характеризуется пятью гиперчувствительными к ДНКазе I сайтами (HS1-5) и необходим для тканеспецифичной и независимой от положения экспрессии нижестоящих генов β-глобина (Li et al.2002 г.; Стаматояннопулос 2005). Предыдущий анализ 3C мышиного локуса β-globin выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). Также было обнаружено, что LCR взаимодействует с элементами HS, расположенными выше (HS-62.5/HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ локуса β-глобина человека и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положения ГС указаны черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»BU661736″,»term_id»:»23373918″,»term_text»:»BU661736″} }BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью локуса β-глобина.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось и указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение не менее трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (SEM). ( C ) Репрезентативное титрование библиотеки 3C в одиночной LMA с праймерами 5C. Увеличивающиеся объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров для 5C-пустыни генов, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено равным 1. Каждое значение гистограммы представляет собой среднее значение по меньшей мере трех ПЦР; полосы представляют S. EM

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя обычный метод 3C. Локус анализировали в эритролейкозной клеточной линии К562 и в EBV-трансформированной лимфобластоидной клеточной линии GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов BAC (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и фрагментами рестрикции EcoRI по всему локусу β-глобина определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействия, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, области консервативной генной пустыни на хромосоме 16 (регион ENr313 ENCODE) (Консорциум проекта ENCODE). 2004).

Нормализованные результаты представлены в . В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие в результате внутренней близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлеобразных взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006). Важно отметить, что прогнозируется постепенное уменьшение случайных столкновений для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 наблюдались высокие частоты взаимодействия, в частности, между LCR и фрагментом рестрикции, расположенным примерно на 40 т.п.н. ниже по течению и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения субнуклеарной локализации.

На основании этого анализа мы пришли к выводу, что конформация локуса β-глобина человека сравнима с локусом мыши с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и в неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в глобин-экспрессирующих клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямых и обратных праймеров 5C, чтобы убедиться, что этот метод может количественно определять продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5С, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA проводили с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (полученной из клеток K562), и образование лигированных прямых и обратных праймеров количественно определяли с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается, когда присутствует неспецифическая ДНК, оно зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

LMA обнаружение петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одиночный LMA для количественного определения взаимодействий образования петель хроматина в локусе β-глобина. Мы сосредоточились на взаимодействиях, включающих LCR и три диагностических фрагмента в локусе β-глобина (обозначены столбиками на рис.): рестрикционный фрагмент, расположенный сразу за LCR, рестрикционный фрагмент, перекрывающий ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между δ- и β-глобиновыми генами.Мы разработали обратный праймер 5C для фрагмента рестрикции, перекрывающего HS5 LCR, и прямые праймеры 5C для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с помощью отдельных пар праймеров 5C в присутствии увеличивающихся количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнение).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем подсчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с контрольной библиотекой. Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы находим, что данные, полученные с помощью LMA, точно воспроизводят данные 3C, включая петлеобразное взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изучаемые здесь частоты взаимодействия (три в локусе β-глобина и одна в контрольной области) быть обнаружены и количественно оценены в мультиплексной реакции LMA.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы рассчитали нормированные частоты взаимодействия, как описано выше. Мы снова получили такие же результаты, как и с обычным 3C (правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием LMA с высокой степенью мультиплексирования

Всесторонний анализ 5C взаимодействий хроматина в больших областях генома потребует высокого уровня мультиплексирования в сочетании с высокопроизводительным методом анализа библиотек 5C.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и изучили два высокопроизводительных метода обнаружения для анализа библиотек 5C: микрочипы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех фрагментов рестрикции EcoRI, которые перекрываются с LCR, и прямые праймеры 5C для 55 фрагментов рестрикции в области 400 т.п.н. вокруг LCR. Эта конструкция праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. ниже).Мы также разработали 10 5C прямых и 10 5C обратных праймеров на участке размером 100 т.п.н. в контрольной области генной пустыни. Прямые и обратные праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема дизайна праймера позволяет обнаруживать матрицу взаимодействий во всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве матриц. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри локуса β-глобина, 100 взаимодействий в пределах генной пустыни и 590 взаимодействий между двумя областями генома. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в . Мы использовали специфические праймеры для ПЦР для количественной оценки количества специфических продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше. Мы обнаружили, что данные 5C точно воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнение) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C резюмируют профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина локуса β-глобина человека HS5 в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микрочипа. Ось и указывает нормализованные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а планки погрешностей представляют SEM. Схематическое изображение всего локуса представлено вверху . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Столбики погрешностей указывают на стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчета. Стандартные отклонения распространялись с использованием дельта-метода. ( D ) Корреляция между профилями локуса β-глобина человека 3C и 5C из клеток K562. Результаты микрочипа и секвенирования ДНК 5C сравнивали с соответствующими данными 3C путем расчета кратности (логарифмическое отношение 5C/3C) для каждой пары взаимодействующих фрагментов (ось y ). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и количественное секвенирование

Мы проверили, можно ли использовать обнаружение на микрочипах и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микрочипов, мы амплифицировали библиотеки 5C, описанные выше, с помощью универсальных праймеров, меченных Cy3.Затем меченые библиотеки 5C гибридизовали с специально разработанным микрочипом, который может обнаруживать специфические продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, имеющими один и тот же полусайт. Для оценки кросс-гибридизации половинного сайта микрочип также содержал зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микрочипа, которая допускает наименьшую перекрестную гибридизацию, каждый зонд был отмечен 18 полусайтами разной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C гибридизовали с массивом и количественно определяли специфическую гибридизацию и гибридизацию с половинным сайтом. Мы обнаружили, что зонды, состоящие из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень кросс-гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, а частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с библиотекой 5C, на сигнал, полученный с контрольной библиотекой (см. Ниже; дополнительная таблица 7).

Крупномасштабный анализ 5C локуса β-глобина человека. ( A ) Положения прямого ( вверху ) и обратного ( внизу ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью размером 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью анализа 5C и микрочипов ( сверху ), 3C ( посередине ) и 5C и количественного секвенирования ( снизу ).Локус β-глобина, показанный выше профилей, включает признаки, описанные в . Стрелка, направленная вперед, указывает на местонахождение альтернативного сайта начала транскрипции ε-глобина. Светло- и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелками указаны ГС, идентифицированные в клетках К562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагается, являются ортологичными HS-62.5/-62.0 в мышином локусе (Farrell et al.2002 г.; Балджер и др. 2003). ( C ) Профиль взаимодействия хроматина HS2/3/4 LCR с областью 400 т.п.о. вокруг LCR, определенный микрочипом ( вверху ) и количественным секвенированием ( внизу ). Цветные вертикальные полосы указывают на взаимодействие между LCR и вышестоящими HS и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C с помощью количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК длиной ~100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул. Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микрочипов, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки, используя платформу GS20, разработанную 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160 000 прочтений последовательности (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали, сколько раз был секвенирован каждый конкретный продукт лигирования 5C (см. Методы; Дополнительная таблица 5).Поскольку каждый продукт лигирования секвенировали много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз, когда продукт 5C был секвенирован в библиотеке 5C, на количество раз, когда он был секвенирован в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ локуса β-глобина

Сначала мы проанализировали профили взаимодействия HS5 по всему локусу β-глобина размером 100 т.п.н., обнаруженные на микрочипе () и количественным секвенированием ().Для сравнения тот же профиль взаимодействия был также определен с помощью обычного 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микрочипов, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C локуса β-глобина в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлеобразное взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-globin, который слабо экспрессируется в клетках K562, но молчит в клетках GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы напрямую сравнили наборы данных 5C и 3C, рассчитав для каждой пары взаимодействующих фрагментов кратную разницу между частотами их взаимодействия, как определено 5C и 3C.Мы находим, что разница в данных 5C, полученных с помощью микрочипового детектирования, и обычного 3C, как правило, менее чем в два раза (). Однако большие различия наблюдались, когда данные 5C, полученные с помощью количественного секвенирования, сравнивали с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном секвенированием, по сравнению с полуколичественной ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на график рассеяния (дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации контрольного региона генной пустыни. ( A ) Положения чередующихся прямых ( вверху ) и обратных ( внизу ) праймеров 5C по всему контрольному региону генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( слева, панель ), с помощью 5C и микрочипов ( посередине, панель ), а также с помощью 5C и количественного секвенирования ( справа, панель ). Частоты взаимодействия нанесены на график в зависимости от геномного расстояния между взаимодействующими фрагментами. Бары представляют SEM. Частоты взаимодействия, обнаруженные в клетках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание. Праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с помощью этих праймеров, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

В совокупности эти результаты служат четким доказательством того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой пропускной способности. .

Взаимодействия между HS5 и вышестоящими элементами

LCR мыши взаимодействует с элементами HS (HS-62.5/HS-60), расположенными до 40 т.п.н. выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли в этой области генома человека функционально эквивалентные взаимодействующие элементы. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.о. выше LCR, ортологичны генам, расположенным на 40 т.п.о. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области родственны.Кроме того, мышиный элемент HS-62.5/HS-60 встроен в последовательность, сходную с последовательностью, расположенной примерно на 90 т. п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная примерно на 90 т.п.н. выше LCR человека, ортологична области, расположенной примерно на 40 т.п.н. выше мышиного локуса, что указывает на то, что эта область может также взаимодействовать с LCR в клетках человека. Чтобы беспристрастно оценить, взаимодействует ли LCR с какими-либо элементами выше по течению в локусе человека, описанный выше эксперимент 5C был разработан для включения анализа большой области, расположенной выше по течению от LCR.

Мы проанализировали профили взаимодействия, полученные микрочиповым обнаружением и количественным секвенированием HS5 с областью до 280 т.п.н. выше LCR. Оба набора данных показали, что взаимодействия в этой области обычно намного ниже, чем взаимодействия, наблюдаемые между LCR и локусом β-globin. Однако в обеих клеточных линиях мы обнаружили повышенные частоты взаимодействия в большом домене, расположенном на 50–100 т.п.н. выше LCR (10). Этот результат был подтвержден обычным анализом 3C (см. верхнюю, среднюю и нижнюю панели). Эта область содержит три гена обонятельных рецепторов и множественные сайты HS (Bulger et al. 2003).

Эти результаты позволяют предположить, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в мышином локусе. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местонахождения новых предполагаемых регуляторных элементов.

Параллельный анализ нескольких профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между несколькими интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, 5C прямой и обратный праймеры были сконструированы так, чтобы обеспечить одновременную детекцию профилей взаимодействия каждого из трех подразделов LCR с 400 т.п.о. окружающего хроматина.Данные, полученные с помощью микрочипового анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2/3/4 фрагмента LCR, очень похож на профиль HS5 (10). Интересно, что мы обнаружили, что в клетках K562 HS2/3/4 чаще взаимодействуют с сайтами по всему локусу β-globin, чем HS5, предполагая, что эти HS могут вносить наибольший вклад в формирование петель хроматина с LCR. 5C анализ 3′-конца LCR, который содержит HS1, не дал достаточного количества продуктов лигирования для получения значительного количества прочтений последовательности.Анализ сигналов гибридизации микрочипов подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали закономерностям, полученным для HS5 и HS2/3/4 (дополнительная таблица 7). ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ локуса β-глобина был сосредоточен на картировании взаимодействий между фиксированным регуляторным элементом, LCR, и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов плохо определены. Здесь мы приводим пример альтернативной схемы дизайна праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Анализ 5C, описанный выше, включал 10 прямых и 10 обратных праймеров 5C для рестрикционных фрагментов, расположенных в контрольной области генетической пустыни (). Важно отметить, что прямые и обратные праймеры были разработаны для чередующихся рестрикционных фрагментов (1).В совокупности эти праймеры обнаруживают взаимодействия хроматина по всей области. Частоты взаимодействия, определенные с помощью микрочипового анализа и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействий снижается с увеличением геномного расстояния. Аналогичные результаты были получены с помощью обычного 3С-анализа.

Графики не показывают, где на хромосоме были измерены частоты конкретных взаимодействий.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямыми и обратными праймерами 5C в виде двумерных тепловых карт, в которых цвет каждого квадрата указывает на частоту взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этом регионе генной пустыни, сильно отличается от наблюдаемого в локусе β-глобина и согласуется со случайным поведением хроматинового волокна без длинных петлевых взаимодействий (Rippe 2001; Dekker et al.2002 г.; Деккер 2006).

Обсуждение

Развитие 3C значительно облегчило обнаружение и изучение цис и транс взаимодействий между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить спектр приложений 3C, позволяя выполнять всестороннее и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа локуса β-глобина

Мы подтвердили 5C путем обнаружения взаимодействий петель хроматина в локусе β-глобина человека. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессированными генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в клетках GM06990 LCR также взаимодействует с элементом 3′-HS1 и большим доменом, расположенным на 50–100 т.п.о. выше по течению. Последняя область соответствует области вокруг HS-62. 5/ HS-60 в мышином локусе (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HS была предложена для создания хроматинового узла или специализированного ядерного компартмента, предназначенного для транскрипции β-globin генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые из HS в локусе β-глобина связываются с инсулятор-связывающим белком CTCF (Farrell et al. 2002; Bulger et al. 2003) (и для человеческого HS5 см. Дополнительную фиг.6), и предполагается, что этот белок обеспечивает их взаимодействие и образование хроматинового узла (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых элементов не влияет непосредственно на экспрессию β-globin (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они могут не регулировать экспрессию β-глобина напрямую, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2/3/4 очень похожи, за исключением того, что HS2/3/4 чаще взаимодействует с локусом β-глобина именно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al., 1993; Peterson et al., 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген globin наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое петлеобразное взаимодействие хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что эта область вовлечена в онтогенетический контроль локуса β-globin (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнение), что позволяет предположить, что петлевое взаимодействие может быть вовлечено в активацию транскрипции. Эта область также содержит промотор большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-globin (Gribnau et al. 2000).Некоторые пациенты, страдающие наследственной персистенцией фетального гемоглобина, имеют делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al., 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными участками γ–δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенного участка, несмотря на наличие несколько слабых предполагаемых сайтов связывания CTCF (дополнительная рис. 6).

Детектирование с помощью микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования с помощью микрочипов, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также наблюдали несколько отличий. Во-первых, динамический диапазон обнаружения микрочипов был меньше, чем у количественного секвенирования, как это наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученных с помощью микрочипового анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ–δ (рис. ). Эти различия могут отражать внутреннюю предвзятость методов обнаружения, но также могут быть связаны с экспериментальными различиями между независимо сгенерированными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает более широкий динамический диапазон и избавляет от необходимости создавать определенный массив для каждой интересующей области генома. С другой стороны, анализ микрочипов в настоящее время более экономичен, особенно когда данный участок генома необходимо анализировать в большом количестве различных условий.

Данные 5C, полученные с помощью секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно оценили 451 взаимодействие между локусом β-глобина и областью пустыни контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-globin и регион генной пустыни должны предпочтительно взаимодействовать. Поэтому мы рассудили, что эти частоты межхромосомных взаимодействий будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие фоновые частоты взаимодействия между двумя областями (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2/3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймера или экспериментальный шум. Будущие крупномасштабные анализы 5C обеспечат более подробное понимание этих проблем.

Применение 5C

5C основан на мультиплексной амплификации, опосредованной лигированием, и поэтому потенциально ограничен количеством праймеров 5C, которые можно использовать в одной реакции.Другие анализы, основанные на LMA, успешно использовали многие тысячи праймеров в одной реакции. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси примерно 6000 праймеров (Bibikova et al. 2005). Другим примером является использование LMA с высокой степенью мультиплексирования с использованием до 20 000 молекулярных инверсионных зондов в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10 000 праймеров 5C в одном эксперименте, можно параллельно обнаружить до 25 миллионов различных взаимодействий хроматина с участием до 40 Мб (10 000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые использовались для создания проанализированных здесь библиотек 5C, прекрасно распознавали обильные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы предполагаем два типа приложений 5C, которые различаются схемами проектирования 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными представляющими интерес элементами генома, подобно описанному здесь анализу локуса β-globin.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис- или в транс-, чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов параллельно в одной реакции с последующим анализом на специально разработанном микрочипе или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого представляющего интерес фиксированного фрагмента, а прямые праймеры 5C конструируют для всех остальных рестрикционных фрагментов, как показано на рис. Этот тип анализа позволит быстро обнаружить сети взаимодействий между несколькими генами и регуляторными элементами в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействия, которые охватывают большинство или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямые и обратные праймеры 5C разработаны для чередующихся фрагментов рестрикции, как это сделано здесь для контрольной области пустыни гена (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой анализ 5C не дает полной карты взаимодействия для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются как прямыми, так и обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с переставленной схемой дизайна праймера 5C для получения частично перекрывающихся матриц взаимодействия. В сочетании эти карты могут давать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будет соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействия может быть использована в качестве инструмента обнаружения для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействия также может предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Подготовка ВАС-селекции и контрольной библиотеки

Контрольная библиотека для человеческого локуса β-глобина и областей генной пустыни (регионы ENCODE ENm009 и ENr313 соответственно) была создана, как описано (Dekker 2006; Miele et al.2006). Вкратце, массив бактериальных искусственных хромосом (ВАС), покрывающих обе геномные области, смешивали, расщепляли с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы BAC из локуса β-глобина и областей генной пустыни были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Для области β-глобина использовали следующие семь клонов ВАС: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов BAC был отобран для охвата области пустыни с геном 0,5 Мб и включает RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Оклендского научно-исследовательского института детской больницы (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из В-лимфоцитов, трансформированных EBV, и была получена из репозиториев клеток Coriell (CCR). Эту клеточную линию культивировали в среде 1640 Мемориального института Розуэлл-Парк (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37°C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C проводили с использованием клеток GM06990 и K562 в логарифмической фазе с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Тотальную РНК из клеток логарифмической фазы выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго(dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно определяли с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические праймеры для β-глобина человека, использованные в этом анализе, приведены в дополнительной таблице 1.

Дизайн праймера 5C

Прямые и обратные праймеры были разработаны для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI. Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления была сосредоточена на уровне 72°C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были разработаны так, чтобы включать 5′-концевой хвост, который включает (5’–3′) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированную последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были разработаны так, чтобы включать 3′-концевой хвост, который включает (5′-3′) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5С содержали по половине сайта рестрикции EcoRI, и только обратные праймеры были фосфорилированы на 5′-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотеку 3C (представляющую примерно 150 000 копий генома) или контрольную библиотеку (5 нг) смешивали с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ ДТТ). Образцы денатурировали в течение 5 мин при 95°С и отжигали в течение 16 ч при 48°С. Отожженные праймеры лигировали в течение 1 ч при 48°C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при рН 7,6, 31,25 мМ ацетата калия, 12,5 мМ ацетата магния, 1,25 мМ НАД, 12,5 мМ ДТТ, 0,125% Тритона Х). -100), содержащую 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65°С в течение 10 мин. Продукты лигирования 5C амплифицировали методом ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в 25-мкл реакциях ПЦР (32 цикла по 30 с денатурации при 95°С, 30 с отжига при 60°С и 30 с удлинения при 72°С). ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления невключенных праймеров и других загрязнителей в соответствии с рекомендациями производителя.

Singleplex и sixplex Анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировали с помощью 35 Циклы ПЦР: 30 с денатурации при 95°С, 30 с отжига при 60°С и 30 с удлинения при 72°С.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали бромистым этидием (0,5 мкг/мл). Анализ Sixplex 5C проводили путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C в образцах шестиплексов обнаруживали с помощью ПЦР со специфическими внутренними праймерами для ПЦР и измеряли на агарозных гелях, как описано выше. Обнаружение продуктов 5C с помощью ПЦР с линейным диапазоном было подтверждено двукратным титрованием серийных разведений мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микрочипа библиотеки 5C

Библиотеки 5C были приготовлены путем проведения мультиплексной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченым обратным праймером для ПЦР, комплементарным общей 3′-концевой хвостовой последовательности обратных праймеров 5C (Cy3 -T3modif). Синтез безмасочной матрицы и гибридизацию проводили со 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al., 1999; Nuwaysir et al., 2002; Kim et al., 2005; Selzer et al.2005). Каждая матрица содержала смысловую цепь предсказанных продуктов лигирования 5C. Массивы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов увеличивающейся длины признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зонда массива (дополнение). Полное описание конструкции массива предоставляется по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp. ) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Высокопроизводительный анализ секвенирования ДНК библиотеки 5C

Библиотеки 5C были созданы с использованием 73 праймеров 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с фосфорилированными 5′-концами ПЦР-праймерами и обрабатывали для одномолекулярного пиросеквенирования, как описано ранее (Margulies et al. 2005). С помощью платформы GS20, разработанной 454 Life Sciences Corp., было получено 550 189 прочтений последовательности на общую сумму 60 миллионов оснований. Средняя длина считывания составила 108 оснований (мода 112 оснований).Каждое чтение было подвергнуто BLAST против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество прочтений, соответствующих каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в локусе β-глобина, 72 взаимодействия в области генной пустыни и 451 взаимодействие между регионами. Данные обобщены в дополнительных таблицах 4 и 5.

Массивно-параллельное решение для картирования взаимодействий между геномными элементами

Реферат

Физические взаимодействия между генетическими элементами, расположенными по всему геному, играют важную роль в регуляции генов и могут быть отождествлены с хромосомой. Методология захвата конформации (3C).3C превращает физические взаимодействия хроматина в специфические продукты лигирования, которые количественно оцениваются индивидуально с помощью ПЦР. Здесь мы представляем высокопроизводительный подход 3C, 3C-Carbon Copy (5C), который использует микрочипы или количественное секвенирование ДНК с использованием технологии 454 в качестве методов обнаружения. Мы применили 5C для анализа области размером 400 т.п.н., содержащей локус β-глобина человека, и области пустыни консервативного гена размером 100 т.п.н. Мы подтвердили 5C, обнаружив несколько ранее идентифицированных петлевых взаимодействий в локусе β-глобина. Мы также идентифицировали новое петлеобразное взаимодействие в клетках K562 между областью контроля локуса β-глобина и межгенной областью γ-β-глобина. Интересно, что эта область участвует в контроле онтогенетических переключений глобиновых генов. 5C должен быть широко применим для крупномасштабного картирования цис-— и транс-— взаимодействующих сетей геномных элементов и для изучения структуры хромосом более высокого порядка.

В настоящее время предпринимаются интенсивные усилия по картированию генов и регуляторных элементов по всему геному человека (Консорциум проекта ENCODE, 2004 г.).Ожидается, что эти исследования выявят множество различных типов элементов, включая те, которые участвуют в регуляции генов, репликации ДНК и организации генома в целом. Анализ всего 1% генома человека уже показал, что гены окружены удивительно большим количеством предполагаемых регуляторных элементов (данные доступны на http://genome.cse.ucsc.edu/encode/).

Чтобы полностью аннотировать геном человека и понять его регуляцию, важно картировать все гены и функциональные элементы, а также определить все взаимосвязи между ними. Например, должны быть идентифицированы все регуляторные элементы каждого гена. Эта попытка осложняется тем, что геномное положение генов и элементов не дает прямой информации о функциональных отношениях между ними. Хорошо известным примером являются энхансеры, которые могут регулировать множественные гены-мишени, расположенные на больших расстояниях в геноме или даже на разных хромосомах, не затрагивая гены, находящиеся непосредственно рядом с ними (Spilianakis et al. 2005; West and Fraser 2005).

Недавние данные указывают на то, что регуляторные элементы могут действовать на больших геномных расстояниях, участвуя в прямом физическом взаимодействии со своими генами-мишенями или с другими элементами (Dekker 2003; de Laat and Grosveld 2003; Chambeyron and Bickmore 2004; West and Fraser 2005). Эти наблюдения указывают на то, что геном может быть организован как сложная трехмерная сеть, которая определяется физическим взаимодействием между генами и элементами. Следовательно, мы предполагаем, что функциональные отношения между генами и регуляторными элементами могут быть определены путем анализа этой сети посредством картирования взаимодействий хроматина.

Физические взаимодействия между элементами могут быть обнаружены с помощью метода захвата хромосомной конформации (3C) (Dekker et al. 2002; Dekker 2003; Splinter et al. 2004; Miele et al. 2006). 3C использует перекрестное связывание формальдегида для ковалентного захвата взаимодействующих сегментов хроматина по всему геному. Взаимодействующие элементы затем расщепляются рестрикционными ферментами и внутримолекулярно лигируются. Частота лигирования двух рестрикционных фрагментов является мерой частоты их взаимодействия в ядре (Dekker et al.2002).

Схематическое изображение 5C. ( A ) Библиотека 3C создается с помощью обычного 3C, а затем преобразуется в библиотеку 5C путем отжига и лигирования олигонуклеотидов 5C в условиях мультиплексирования. Затем библиотеки 5C анализируют на микрочипе или с помощью количественного секвенирования. ( B ) Дизайн грунтовки 5C. Прямые праймеры 5C отжигаются со смысловой цепью 3′-конца рестрикционных фрагментов и включают половину выбранного сайта рестрикции. Все прямые праймеры имеют общий 5′-концевой хвост, содержащий промоторную последовательность Т7.Обратные праймеры 5C отжигаются с антисмысловой цепью 3′-конца рестрикционных фрагментов, включая половину сайта рестрикции. Все обратные праймеры содержат общий 3′-концевой хвост с комплементарной последовательностью Т3 (Т3с) и фосфорилированы на 5′-конце. Прямой и обратный праймеры 5C отжигают с одной и той же цепью продуктов лигирования «голова к голове», присутствующих в библиотеке 3C.

3C первоначально использовался для изучения пространственной организации хромосомы III дрожжей (Dekker et al. 2002), а затем применялся для анализа нескольких локусов млекопитающих, таких как локус β-глобина (Tolhuis et al.2002 г.; Палстра и др. 2003 г.; Вакок и др. 2005), локус цитокинов Т-хелперов 2 типа (Spilianakis and Flavell 2004), локус κ иммуноглобулина (Liu and Garrard 2005) и импринтированный локус Igf2 (Murrell et al. 2004). Эти исследования выявили прямые взаимодействия между энхансерами и промоторами генов-мишеней, при этом связывающая ДНК закручивается наружу. 3С также использовали для обнаружения взаимодействий транс между хромосомами дрожжей (Dekker et al. 2002) и между функционально родственными элементами, расположенными на разных хромосомах мыши (Spilianakis et al.2005 г.; Линг и др. 2006 г.; Сюй и др. 2006). В совокупности эти исследования показывают, что дальнодействующие взаимодействия цис и транс играют широко распространенную роль в регуляции генома и что 3C является удобным подходом для картирования этой сети взаимодействий.

3C использует ПЦР для выявления индивидуальных взаимодействий хроматина, что особенно подходит для относительно небольших исследований, направленных на анализ взаимодействий между набором элементов-кандидатов. Однако обнаружение с помощью ПЦР не способствует ab initio и крупномасштабному картированию взаимодействий хроматина.Чтобы преодолеть эту проблему, библиотеки 3C необходимо анализировать с использованием высокопроизводительного метода обнаружения, такого как микрочипы или секвенирование ДНК. Чрезвычайная сложность библиотеки 3C и низкая относительная распространенность каждого конкретного продукта лигирования затрудняют прямой крупномасштабный анализ. Здесь мы представляем новую методологию на основе 3C для крупномасштабного параллельного обнаружения взаимодействий хроматина. Мы называем этот метод 3C-Carbon Copy или «5C». 5C использует сильно мультиплексированную амплификацию, опосредованную лигированием (LMA), чтобы сначала «скопировать», а затем амплифицировать части библиотеки 3C с последующим обнаружением на микрочипах или количественным секвенированием ДНК.

5C был разработан и подтвержден путем анализа локуса β-глобина человека и консервативной области генной пустыни, расположенной на хромосоме 16 человека. Мы обнаружили, что 5C количественно обнаруживает несколько известных взаимодействий с образованием петель ДНК. Интересно, что анализ 5C также выявил петлеобразное взаимодействие между β-globin Locus Control Region (LCR) и межгенной областью γ-δ. Ранее несколько линий доказательств предполагали, что эта область играет роль в регуляции контролируемого развитием переключения с экспрессии γ-глобина в фетальных клетках на экспрессию β-глобина во взрослых клетках (Calzolari et al. 1999 г.; Грибнау и др. 2000).

5C должен широко применяться для определения связности цис и транс регуляторных элементов в больших геномных регионах. Кроме того, эксперименты 5C могут быть спланированы таким образом, чтобы можно было создавать полные карты взаимодействия для любой крупной интересующей области генома, которые могут выявить расположение новых регуляторных элементов генов, а также могут дать подробное представление о складках хромосом более высокого порядка.

Результаты

Метод 3C подробно описан (Dekker et al.2002 г.; Сплинтер и др. 2004 г.; Вакок и др. 2005 г.; Деккер 2006; Миле и др. 2006) и проиллюстрировано в . Эксперимент 3C создает сложную библиотеку продуктов лигирования, которая отражает все взаимодействия хроматина, происходящие в геноме. Обилие каждого конкретного продукта лигирования в библиотеке является мерой частоты взаимодействия двух соответствующих локусов.

В типичном анализе 3C отдельные частоты взаимодействия определяются путем количественного определения образования предполагаемых продуктов лигирования «голова к голове» с использованием полуколичественной ПЦР (). В качестве контроля ПЦР используют библиотеку, содержащую все продукты лигирования в эквимолярных количествах. Контрольная библиотека создается путем смешивания эквимолярных количеств минимально перекрывающихся клонов ВАС, покрывающих интересующую область генома (Palstra et al. 2003; Dekker 2006). Затем эту смесь переваривают и случайным образом лигируют. Частоты взаимодействия определяют путем расчета соотношения продукта ПЦР, полученного с библиотекой 3C, и количества, полученного с контрольной библиотекой.

Описание технологии 5C

Мы разработали 5C для обнаружения продуктов лигирования в библиотеках 3C с помощью мультиплексной LMA ().LMA широко используется для обнаружения и амплификации специфических последовательностей-мишеней с использованием пар праймеров, которые отжигаются рядом друг с другом на одной и той же цепи ДНК (; Landegren et al., 1988; Li et al., 2005; Peck et al., 2006). Лигировать можно только праймеры, отожженные рядом друг с другом. Включение универсальных хвостов на концах праймеров 5C позволяет последующую амплификацию лигированных праймеров. Подходы, основанные на LMA, являются количественными и могут выполняться при высоком уровне мультиплексирования с использованием тысяч праймеров в одной реакции (Fan et al.2004 г.; Бибикова и др. 2005 г.; Харденбол и др. 2005 г.; Ван и др. 2005).

Для анализа взаимодействий хроматина с помощью 5C сначала создается библиотека 3C с использованием обычного метода 3C. Затем смесь праймеров 5C отжигают с библиотекой 3C и лигируют. Используются два типа 5С-праймеров: 5С-прямой и 5С-обратный праймеры. Эти праймеры сконструированы таким образом, что прямые и обратные праймеры отжигаются через лигированные соединения продуктов лигирования «голова к голове», присутствующих в библиотеке 3C (12). Праймеры 5C, которые отжигают рядом друг с другом, затем лигируют лигазой Taq.На этом этапе создается библиотека 5C, которая амплифицируется универсальными праймерами для ПЦР, которые отжигаются с хвостами праймеров 5C. Прямой и обратный праймеры 5C лигируются только в том случае, если оба отжигаются с определенным продуктом лигирования 3C. Таким образом, библиотека 3C определяет, какие продукты лигирования 5C генерируются и как часто. В результате библиотека 5С является количественной «копией» части библиотеки 3С, определенной по набору праймеров 5С.

Прямые и обратные праймеры 5C содержат уникальную последовательность, соответствующую смысловой и антисмысловой цепям 3′-концов рестрикционных фрагментов, соответственно (; более подробную информацию см. в дополнительных материалах).Праймеры также содержат универсальные хвосты для амплификации (T7 на 5′-концах прямых праймеров и T3c на 3′-концах обратных праймеров) (). Чтобы проанализировать взаимодействия между многими рестрикционными фрагментами, несколько прямых и обратных праймеров смешивают вместе в одной и той же мультиплексной реакции 5C. Поскольку предсказанные прямой и обратный праймеры каждого рестрикционного фрагмента комплементарны, в данном эксперименте с 5C можно использовать только один праймер на фрагмент, либо прямой, либо обратный. Для облегчения лигирования все обратные праймеры фосфорилированы на 5′-концах. Эта конструкция праймера 5C позволяет одновременно амплифицировать все потенциальные взаимодействия между всеми рестрикционными фрагментами, распознаваемыми прямым праймером, и всеми рестрикционными фрагментами, распознаваемыми обратным праймером.

Хроматиновая петля в локусе β-глобина человека

Мы разработали и оптимизировали подход 5C путем анализа локуса β-глобина человека. Этот локус был выбран потому, что ранее было обнаружено несколько петлевых взаимодействий с помощью 3C, а также второго метода, RNA-TRAP (Carter et al.2002 г.; Толхуис и др. 2002), и поэтому обнаружение этих циклических взаимодействий с помощью 5C можно использовать для проверки нового метода.

Локус β-глобина человека состоит из пяти регулируемых в процессе развития β-глобин-подобных генов (ε, HBE ; Aγ и Gγ, HBG1 и HBG2 ; δ, HBD ; и β, 0 HBB ), один псевдоген ( HBpsi ) и область контроля локуса (LCR), расположенную выше кластера генов (). LCR характеризуется пятью гиперчувствительными к ДНКазе I сайтами (HS1-5) и необходим для тканеспецифичной и независимой от положения экспрессии нижестоящих генов β-глобина (Li et al.2002 г.; Стаматояннопулос 2005). Предыдущий анализ 3C мышиного локуса β-globin выявил опосредованные транскрипционным фактором петлевые взаимодействия между LCR и транскрибируемыми глобиновыми генами (Drissen et al. 2004; Vakoc et al. 2005). Также было обнаружено, что LCR взаимодействует с элементами HS, расположенными выше (HS-62.5/HS-60) и ниже (3′-HS1) от локуса (Tolhuis et al. 2002).

Анализ локуса β-глобина человека и развитие 5C. ( A ) Схематическое изображение локуса β-глобина человека.Гены β-глобина и псевдоген показаны красными и желтыми стрелками соответственно. Положения ГС указаны черными стрелками. Обонятельные гены и псевдогены представлены черными и желтыми прямоугольниками соответственно. Местоположение гена с неизвестной функцией (EST {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»BU661736″,»term_id»:»23373918″,»term_text»:»BU661736″} }BU661736) обозначен зеленым овалом. ( B ) 3C анализ взаимодействий между LCR (HS5) и остальной частью локуса β-глобина.Частоты взаимодействия измеряли с помощью полуколичественной ПЦР в клетках K562 (локус ON) и GM06990 (локус OFF). Ось и указывает нормализованные частоты взаимодействия; ось x показывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение не менее трех реакций ПЦР; столбцы представляют собой стандартную ошибку среднего (SEM). ( C ) Репрезентативное титрование библиотеки 3C в одиночной LMA с праймерами 5C. Увеличивающиеся объемы библиотеки 3C из клеток K562 анализировали с использованием праймеров для 5C-пустыни генов, а амплифицированные продукты лигирования 5C анализировали на агарозном геле.Звездочка указывает на неспецифическую полосу. ( D ) Количественное определение титрования показано в C . Каждая точка данных соответствует среднему значению трех реакций ПЦР; столбцы представляют S.E.M. ( E ) 3C, singleplex и sixplex LMA обнаружение петлевых взаимодействий между HS5 и геном Aγ-глобина HBG1 . Частоты взаимодействия от обеих клеточных линий были выражены относительно взаимодействия K562 LCR-Aγ-глобин ( HBG1 ), которое было установлено равным 1. Каждое значение гистограммы представляет собой среднее значение по меньшей мере трех ПЦР; полосы представляют S.EM

Сначала мы проверили наличие петель хроматина в локусе β-глобина человека, используя обычный метод 3C. Локус анализировали в эритролейкозной клеточной линии К562 и в EBV-трансформированной лимфобластоидной клеточной линии GM06990. Клетки K562 экспрессируют высокие уровни ε- и γ-глобина, тогда как клетки GM06990 не экспрессируют локус β-глобина (дополнение). Библиотеки 3C были созданы как из клеточных линий, так и из контрольной библиотеки, которая была создана с использованием серии минимально перекрывающихся клонов BAC (см. Методы).Частоты взаимодействия между фрагментом EcoRI, перекрывающим элемент HS5 LCR, и фрагментами рестрикции EcoRI по всему локусу β-глобина определяли с помощью ПЦР. Чтобы обеспечить прямое количественное сравнение частот взаимодействия, определенных в клетках K562 и клетках GM06990, частоты взаимодействий были нормализованы с использованием набора из 12 частот взаимодействий, обнаруженных в контрольной области, области консервативной генной пустыни на хромосоме 16 (регион ENr313 ENCODE) (Консорциум проекта ENCODE). 2004).

Нормализованные результаты представлены в . В обеих клеточных линиях мы обнаружили, что HS5 часто взаимодействует с соседними фрагментами ДНК. Эти взаимодействия, вероятно, отражают нефункциональные случайные столкновения, возникающие в результате внутренней близости соседних рестрикционных фрагментов (Dekker et al. 2002; Dekker 2006). Частые случайные взаимодействия между соседними геномными фрагментами, вероятно, зависят от локальных физических свойств хроматинового волокна и ограничивают возможность обнаружения специфических петлеобразных взаимодействий между элементами, разделенными небольшими геномными расстояниями (2–5 т.п.н.) (Dekker 2006; Gheldof et al.2006). Важно отметить, что прогнозируется постепенное уменьшение случайных столкновений для сайтов, разделенных все более большими геномными расстояниями. В клетках K562 наблюдались высокие частоты взаимодействия, в частности, между LCR и фрагментом рестрикции, расположенным примерно на 40 т.п.н. ниже по течению и перекрывающим ген Aγ-глобина ( HBG1 ), что указывает на наличие сильного петлевого взаимодействия. Мы также обнаружили частое взаимодействие между LCR и элементом 3′-HS1. Интересно, что это взаимодействие также присутствовало в клетках GM06990.Предыдущие исследования мышиного локуса показали, что аналогичное взаимодействие также происходит в неэкспрессирующих эритроидных клетках-предшественниках (Palstra et al. 2003).

Наконец, наш анализ выявил менее частые случайные столкновения между соседними рестрикционными фрагментами вокруг LCR в клетках K562 по сравнению с клетками GM06990. Мы наблюдали сходные различия в случайных столкновениях вокруг активного и неактивного промотора FMR1 (Gheldof et al. 2006) и предположили, что эти различия могут отражать зависимую от транскрипции модуляцию экспансии хроматина или изменения субнуклеарной локализации.

На основании этого анализа мы пришли к выводу, что конформация локуса β-глобина человека сравнима с локусом мыши с петлевыми взаимодействиями между LCR и 3′-HS1 как в экспрессирующих, так и в неэкспрессирующих клетках крови. Взаимодействие между LCR и активным геном Aγ-глобина наблюдается только в глобин-экспрессирующих клетках K562.

Обнаружение LMA продуктов лигирования 3C

Мы использовали обнаружение петель хроматина в локусе β-глобина для разработки и оптимизации технологии 5C.LMA сначала выполняли с одной парой прямых и обратных праймеров 5C, чтобы убедиться, что этот метод может количественно определять продукт лигирования в контексте библиотеки 3C. Мы разработали пару праймеров 5С, которая распознает продукт лигирования, образованный двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. LMA проводили с этой парой праймеров в присутствии возрастающих количеств библиотеки 3C (полученной из клеток K562), и образование лигированных прямых и обратных праймеров количественно определяли с помощью ПЦР-амплификации с парой универсальных праймеров T7 и T3.Мы обнаружили, что лигирование праймеров 5C не наблюдается, когда присутствует неспецифическая ДНК, оно зависит от количества библиотеки 3C и требует лигазы Taq (). Мы пришли к выводу, что LMA можно использовать для количественного определения продуктов лигирования, присутствующих в библиотеке 3C.

LMA обнаружение петель между LCR и геном Aγ-глобина

Мы определили, можно ли использовать одиночный LMA для количественного определения взаимодействий образования петель хроматина в локусе β-глобина. Мы сосредоточились на взаимодействиях, включающих LCR и три диагностических фрагмента в локусе β-глобина (обозначены столбиками на рис.): рестрикционный фрагмент, расположенный сразу за LCR, рестрикционный фрагмент, перекрывающий ген Aγ-глобина HBG1 , и рестрикционный фрагмент, расположенный между δ- и β-глобиновыми генами.Мы разработали обратный праймер 5C для фрагмента рестрикции, перекрывающего HS5 LCR, и прямые праймеры 5C для трех других фрагментов. Линейный диапазон обнаружения 5C определяли с помощью отдельных пар праймеров 5C в присутствии увеличивающихся количеств библиотек 3C (из клеток K562 и GM06990) или контрольной библиотеки (дополнение).

Частоты взаимодействия между HS5 и тремя другими сайтами в локусе β-глобина определяли путем подсчета количества лигированных праймеров 5C, полученных с библиотекой 3C, и количества, полученного с контрольной библиотекой. Для нормализации использовали частоту взаимодействия между двумя соседними рестрикционными фрагментами, расположенными в контрольной области генной пустыни. Нормализованные частоты взаимодействия показаны на средней панели. Мы находим, что данные, полученные с помощью LMA, точно воспроизводят данные 3C, включая петлеобразное взаимодействие между LCR и геном Aγ-глобина.

Затем мы проверили, могут ли четыре изучаемые здесь частоты взаимодействия (три в локусе β-глобина и одна в контрольной области) быть обнаружены и количественно оценены в мультиплексной реакции LMA.Мы выполнили LMA со смесью шести праймеров 5C и использовали ПЦР со специфическими праймерами для количественной оценки частоты лигирования конкретных пар праймеров 5C. Затем мы рассчитали нормированные частоты взаимодействия, как описано выше. Мы снова получили такие же результаты, как и с обычным 3C (правая панель). Вместе эти эксперименты демонстрируют, что LMA можно использовать для количественного определения взаимодействий хроматина.

Создание сложных библиотек 5C с использованием LMA с высокой степенью мультиплексирования

Всесторонний анализ 5C взаимодействий хроматина в больших областях генома потребует высокого уровня мультиплексирования в сочетании с высокопроизводительным методом анализа библиотек 5C.Поэтому мы протестировали LMA на более высоких уровнях мультиплексирования и изучили два высокопроизводительных метода обнаружения для анализа библиотек 5C: микрочипы и количественное секвенирование ДНК.

Мы разработали обратные праймеры 5C для каждого из трех фрагментов рестрикции EcoRI, которые перекрываются с LCR, и прямые праймеры 5C для 55 фрагментов рестрикции в области 400 т.п.н. вокруг LCR. Эта конструкция праймера позволяет обнаруживать петлевые взаимодействия между каждым из трех участков LCR и окружающим хроматином параллельно в одном эксперименте (см. ниже).Мы также разработали 10 5C прямых и 10 5C обратных праймеров на участке размером 100 т.п.н. в контрольной области генной пустыни. Прямые и обратные праймеры были разработаны для распознавания чередующихся рестрикционных фрагментов. Эта схема дизайна праймера позволяет обнаруживать матрицу взаимодействий во всей контрольной области (см. Ниже).

Мы выполнили LMA со смесью всех 78 праймеров 5C, используя библиотеки 3C из K562 и GM06990 и контрольную библиотеку в качестве матриц. Каждая библиотека 5C содержала до 845 различных продуктов лигирования 5C (продукты 13 обратных праймеров и 65 прямых праймеров).Эти продукты включали 165 возможных взаимодействий внутри локуса β-глобина, 100 взаимодействий в пределах генной пустыни и 590 взаимодействий между двумя областями генома. Мы проверили, что библиотеки 5C представляют собой количественные копии выбранной фракции библиотек 3C. Для этого мы снова проанализировали тот же набор из четырех частот взаимодействия, что и в . Мы использовали специфические праймеры для ПЦР для количественной оценки количества специфических продуктов лигирования 5C в библиотеках 5C и определили нормализованные частоты взаимодействия между LCR и тремя положениями локуса β-глобина, как описано выше. Мы обнаружили, что данные 5C точно воспроизводят профиль взаимодействия 3C в обеих клеточных линиях (дополнение) с сильными петлевыми взаимодействиями между LCR и геном Aγ-глобина HBG1 в клетках K562.

Микроматричный анализ и секвенирование ДНК библиотек 5C резюмируют профили взаимодействия 3C. ( A ) 5C анализ взаимодействий хроматина локуса β-глобина человека HS5 в клетках K562 (ON) и GM06990 (OFF), обнаруженных с помощью микрочипа. Ось и указывает нормализованные частоты взаимодействия.Ось x указывает положение генома относительно LCR. Каждая точка данных представляет собой среднее значение шести сигналов гибридизации, полученных с зондами из 38–48 оснований, а планки погрешностей представляют SEM. Схематическое изображение всего локуса представлено вверху . ( B ) Стандартный 3C-анализ взаимодействий человеческого β-глобина HS5 с хроматином. ( C ) 5C анализ взаимодействий человеческого β-глобина HS5, обнаруженный с помощью количественного секвенирования ДНК. Столбики погрешностей указывают на стандартное отклонение.Мы предположили, что данные подсчета были получены для распределения Пуассона и, таким образом, что стандартное отклонение равно квадратному корню из числа подсчета. Стандартные отклонения распространялись с использованием дельта-метода. ( D ) Корреляция между профилями локуса β-глобина человека 3C и 5C из клеток K562. Результаты микрочипа и секвенирования ДНК 5C сравнивали с соответствующими данными 3C путем расчета кратности (логарифмическое отношение 5C/3C) для каждой пары взаимодействующих фрагментов (ось y ). Ось x указывает положение генома относительно LCR.Цветная вертикальная полоса на всех панелях подчеркивает взаимодействие между LCR и областью между генами γ- и δ-глобина, которая содержит псевдоген β-глобина.

Анализ библиотек 5C на микрочипах и количественное секвенирование

Мы проверили, можно ли использовать обнаружение на микрочипах и количественное секвенирование для всестороннего анализа состава библиотек 5C. Во-первых, чтобы облегчить обнаружение микрочипов, мы амплифицировали библиотеки 5C, описанные выше, с помощью универсальных праймеров, меченных Cy3.Затем меченые библиотеки 5C гибридизовали с специально разработанным микрочипом, который может обнаруживать специфические продукты лигирования 5C. Поскольку каждый продукт 5C состоит из двух полусайтов, каждый из которых соответствует праймеру 5C, может происходить перекрестная гибридизация неспецифических продуктов 5C с зондами, имеющими один и тот же полусайт. Для оценки кросс-гибридизации половинного сайта микрочип также содержал зонды, которые распознают только один из 78 праймеров 5C, присутствующих в библиотеке. Чтобы определить оптимальную длину зондов микрочипа, которая допускает наименьшую перекрестную гибридизацию, каждый зонд был отмечен 18 полусайтами разной длины в диапазоне от 15 до 32 оснований (общая длина зонда в диапазоне от 30 до 64 оснований).Библиотеки 5C гибридизовали с массивом и количественно определяли специфическую гибридизацию и гибридизацию с половинным сайтом. Мы обнаружили, что зонды, состоящие из двух полусайтов длиной от 19 до 24 оснований, демонстрируют самый низкий относительный уровень кросс-гибридизации полусайтов (см. Приложение). Данные, полученные с этими шестью длинами признаков, были усреднены, а частоты взаимодействия были рассчитаны путем деления сигнала гибридизации, полученного с библиотекой 5C, на сигнал, полученный с контрольной библиотекой (см. Ниже; дополнительная таблица 7).

Крупномасштабный анализ 5C локуса β-глобина человека. ( A ) Положения прямого ( вверху ) и обратного ( внизу ) праймеров 5C в локусе β-глобина. ( B ) Профиль взаимодействия хроматина HS5 с областью размером 400 т.п.н., окружающей LCR. Физические взаимодействия в клетках K562 (ON) и GM06990 (OFF) измеряли с помощью анализа 5C и микрочипов ( сверху ), 3C ( посередине ) и 5C и количественного секвенирования ( снизу ).Локус β-глобина, показанный выше профилей, включает признаки, описанные в . Стрелка, направленная вперед, указывает на местонахождение альтернативного сайта начала транскрипции ε-глобина. Светло- и темно-оранжевые овалы представляют гипотетические гены убиквилина 3 ( UBQLN3 ) и MGC20470 соответственно. Стрелками указаны ГС, идентифицированные в клетках К562. Красные стрелки указывают на HS, идентифицированные в клетках K562, которые, как предполагается, являются ортологичными HS-62.5/-62.0 в мышином локусе (Farrell et al.2002 г.; Балджер и др. 2003). ( C ) Профиль взаимодействия хроматина HS2/3/4 LCR с областью 400 т.п.о. вокруг LCR, определенный микрочипом ( вверху ) и количественным секвенированием ( внизу ). Цветные вертикальные полосы указывают на взаимодействие между LCR и вышестоящими HS и межгенной областью γ – δ.

Во-вторых, мы проанализировали состав библиотек 5C с помощью количественного секвенирования. Библиотеки 5C состоят из линейных молекул ДНК длиной ~100 п.н., что делает их идеально подходящими для высокопроизводительного пиросеквенирования одиночных молекул. Мы создали аналогичные библиотеки 5C, которые использовались для обнаружения микрочипов, за исключением того, что пять из 65 прямых праймеров были исключены. Мы проанализировали 5C и контрольные библиотеки, используя платформу GS20, разработанную 454 Life Sciences Corp. (Margulies et al. 2005). Для каждой библиотеки мы получили не менее 160 000 прочтений последовательности (дополнительная таблица 4). Для каждой последовательности мы определили, какую пару лигированных праймеров 5C она представляет, и подсчитали, сколько раз был секвенирован каждый конкретный продукт лигирования 5C (см. Методы; Дополнительная таблица 5).Поскольку каждый продукт лигирования секвенировали много раз (среднее количество внутрихромосомных взаимодействий составляло 133 для K562, 53 для GM06990 и 134 для контрольной библиотеки), было получено количественное определение частот взаимодействий. Частоты взаимодействия рассчитывали путем деления количества раз, когда продукт 5C был секвенирован в библиотеке 5C, на количество раз, когда он был секвенирован в контрольной библиотеке (см. Дополнительную таблицу 6).

Крупномасштабный 5C-анализ локуса β-глобина

Сначала мы проанализировали профили взаимодействия HS5 по всему локусу β-глобина размером 100 т.п.н., обнаруженные на микрочипе () и количественным секвенированием ().Для сравнения тот же профиль взаимодействия был также определен с помощью обычного 3C, и данные были нормализованы с использованием частот взаимодействия, определенных в контрольной области (). Как обнаружение микрочипов, так и количественное секвенирование воспроизводили общий профиль взаимодействия 3C локуса β-глобина в клетках K562 и GM06990. Во всех трех наборах данных мы обнаружили, что LCR специфически и сильно взаимодействует с генами γ-глобина в клетках K562. В обеих клеточных линиях мы обнаружили петлеобразное взаимодействие между LCR и элементом 3′-HS1.

Интересно, что анализы 3C и 5C также выявили сильные взаимодействия между LCR и областью, расположенной между генами γ- и δ-глобина в клетках K562. Эта область содержит псевдоген β-globin, который слабо экспрессируется в клетках K562, но молчит в клетках GM06990, и сайт инициации межгенного транскрипта (Gribnau et al. 2000).

Мы напрямую сравнили наборы данных 5C и 3C, рассчитав для каждой пары взаимодействующих фрагментов кратную разницу между частотами их взаимодействия, как определено 5C и 3C.Мы находим, что разница в данных 5C, полученных с помощью микрочипового детектирования, и обычного 3C, как правило, менее чем в два раза (). Однако большие различия наблюдались, когда данные 5C, полученные с помощью количественного секвенирования, сравнивали с данными 3C (). Это может быть связано с тем, что динамический диапазон количественного секвенирования оказывается выше, чем у полуколичественной ПЦР или микрочипов, что приводит к более высоким пикам и более низким впадинам в профиле, полученном секвенированием, по сравнению с полуколичественной ПЦР.Мы также определили корреляцию между данными 5C и 3C напрямую, нанеся данные на график рассеяния (дополнение). Мы обнаружили высокую степень корреляции ( r 2 = 0,73 для набора данных, полученного секвенированием и r 2 = 0,75 для набора данных, полученных на микрочипе).

Анализ конформации контрольного региона генной пустыни. ( A ) Положения чередующихся прямых ( вверху ) и обратных ( внизу ) праймеров 5C по всему контрольному региону генной пустыни.( B ) Частоты взаимодействия хроматина в области генной пустыни, определенные с помощью обычного 3C ( слева, панель ), с помощью 5C и микрочипов ( посередине, панель ), а также с помощью 5C и количественного секвенирования ( справа, панель ). Частоты взаимодействия нанесены на график в зависимости от геномного расстояния между взаимодействующими фрагментами. Бары представляют SEM. Частоты взаимодействия, обнаруженные в клетках K562, также представлены в виде двумерных тепловых карт, на которых цвет каждого квадрата является мерой частоты взаимодействия.Примечание. Праймеры 3, 6 и 20 распознают повторяющиеся последовательности. Эти праймеры были включены для создания библиотек 5C, но данные, полученные с помощью этих праймеров, не включены в B . Частоты взаимодействия, полученные с этими праймерами, представлены в дополнительной таблице 7.

В совокупности эти результаты служат четким доказательством того, что 5C в сочетании с обнаружением микрочипов или количественным секвенированием является мощной методологией для количественного определения взаимодействий хроматина в условиях высокой пропускной способности. .

Взаимодействия между HS5 и вышестоящими элементами

LCR мыши взаимодействует с элементами HS (HS-62.5/HS-60), расположенными до 40 т.п.н. выше LCR (Tolhuis et al. 2002; Palstra et al. 2003). Неизвестно, присутствуют ли в этой области генома человека функционально эквивалентные взаимодействующие элементы. Было отмечено, что гены обонятельных рецепторов, расположенные примерно на 90 т.п.о. выше LCR, ортологичны генам, расположенным на 40 т.п.о. выше мышиного локуса (Bulger et al. 2000), указывая на то, что эти области родственны.Кроме того, мышиный элемент HS-62.5/HS-60 встроен в последовательность, сходную с последовательностью, расположенной примерно на 90 т. п.н. выше LCR человека (Bulger et al. 2003). Эти наблюдения показывают, что область, расположенная примерно на 90 т.п.н. выше LCR человека, ортологична области, расположенной примерно на 40 т.п.н. выше мышиного локуса, что указывает на то, что эта область может также взаимодействовать с LCR в клетках человека. Чтобы беспристрастно оценить, взаимодействует ли LCR с какими-либо элементами выше по течению в локусе человека, описанный выше эксперимент 5C был разработан для включения анализа большой области, расположенной выше по течению от LCR.

Мы проанализировали профили взаимодействия, полученные микрочиповым обнаружением и количественным секвенированием HS5 с областью до 280 т.п.н. выше LCR. Оба набора данных показали, что взаимодействия в этой области обычно намного ниже, чем взаимодействия, наблюдаемые между LCR и локусом β-globin. Однако в обеих клеточных линиях мы обнаружили повышенные частоты взаимодействия в большом домене, расположенном на 50–100 т.п.н. выше LCR (10). Этот результат был подтвержден обычным анализом 3C (см. верхнюю, среднюю и нижнюю панели). Эта область содержит три гена обонятельных рецепторов и множественные сайты HS (Bulger et al. 2003).

Эти результаты позволяют предположить, что область, расположенная на 50–100 т.п.н. выше LCR в геноме человека, находится в относительно непосредственной близости от LCR и, следовательно, может быть функционально эквивалентна геномной области, расположенной на 40 т.п.н. выше LCR в мышином локусе. . Кроме того, эти результаты показывают, что крупномасштабное картирование взаимодействий с использованием 5C может значительно облегчить обнаружение местонахождения новых предполагаемых регуляторных элементов.

Параллельный анализ нескольких профилей взаимодействия

Основным преимуществом 5C является тот факт, что взаимодействия между несколькими интересующими элементами и другими геномными элементами можно анализировать параллельно в одном эксперименте. Описанный здесь эксперимент 5C был разработан, чтобы проиллюстрировать этот аспект методологии. Как описано выше, 5C прямой и обратный праймеры были сконструированы так, чтобы обеспечить одновременную детекцию профилей взаимодействия каждого из трех подразделов LCR с 400 т.п.о. окружающего хроматина.Данные, полученные с помощью микрочипового анализа и количественного секвенирования библиотек 5C, показали, что профиль взаимодействия рестрикционного фрагмента, перекрывающего HS2/3/4 фрагмента LCR, очень похож на профиль HS5 (10). Интересно, что мы обнаружили, что в клетках K562 HS2/3/4 чаще взаимодействуют с сайтами по всему локусу β-globin, чем HS5, предполагая, что эти HS могут вносить наибольший вклад в формирование петель хроматина с LCR. 5C анализ 3′-конца LCR, который содержит HS1, не дал достаточного количества продуктов лигирования для получения значительного количества прочтений последовательности.Анализ сигналов гибридизации микрочипов подтвердил низкие уровни продуктов лигирования, образованных с праймером 5C для HS1, но общие закономерности частот взаимодействия для клеток K562 и GM06990 соответствовали закономерностям, полученным для HS5 и HS2/3/4 (дополнительная таблица 7). ).

Крупномасштабный 5C-анализ контрольной области генной пустыни

5C-анализ локуса β-глобина был сосредоточен на картировании взаимодействий между фиксированным регуляторным элементом, LCR, и окружающим хроматином.Эксперименты 5C также можно спланировать так, чтобы получить более глобальный набор данных, что особенно полезно, когда положения регуляторных элементов плохо определены. Здесь мы приводим пример альтернативной схемы дизайна праймеров 5C, которая дает представление об общей пространственной конформации геномной области.

Анализ 5C, описанный выше, включал 10 прямых и 10 обратных праймеров 5C для рестрикционных фрагментов, расположенных в контрольной области генетической пустыни (). Важно отметить, что прямые и обратные праймеры были разработаны для чередующихся рестрикционных фрагментов (1).В совокупности эти праймеры обнаруживают взаимодействия хроматина по всей области. Частоты взаимодействия, определенные с помощью микрочипового анализа и количественного секвенирования, наносили на график в зависимости от геномного расстояния между взаимодействующими рестрикционными фрагментами. Было обнаружено, что в обеих клеточных линиях частота взаимодействий снижается с увеличением геномного расстояния. Аналогичные результаты были получены с помощью обычного 3С-анализа.

Графики не показывают, где на хромосоме были измерены частоты конкретных взаимодействий.Чтобы лучше проиллюстрировать получение глобальной карты взаимодействия, мы также представили частоты взаимодействия между прямыми и обратными праймерами 5C в виде двумерных тепловых карт, в которых цвет каждого квадрата указывает на частоту взаимодействия между рестрикционными фрагментами. Частоты взаимодействия, отображаемые по диагонали, отражают взаимодействия между фрагментами, расположенными близко друг к другу вдоль хромосомы. Общий паттерн взаимодействий, наблюдаемый в этом регионе генной пустыни, сильно отличается от наблюдаемого в локусе β-глобина и согласуется со случайным поведением хроматинового волокна без длинных петлевых взаимодействий (Rippe 2001; Dekker et al.2002 г.; Деккер 2006).

Обсуждение

Развитие 3C значительно облегчило обнаружение и изучение цис и транс взаимодействий между генами и регуляторными элементами. Здесь мы разработали технологию 5C, новое расширение 3C, которое должно значительно расширить спектр приложений 3C, позволяя выполнять всестороннее и крупномасштабное картирование взаимодействий хроматина. Широкомасштабное применение 5C предоставит информацию о взаимоотношениях между генами и регуляторными элементами и может быть использовано для идентификации новых регуляторных элементов и выявления структурных особенностей хромосом более высокого порядка.

Подтверждение 5C посредством анализа локуса β-глобина

Мы подтвердили 5C путем обнаружения взаимодействий петель хроматина в локусе β-глобина человека. Наиболее заметное взаимодействие наблюдалось между LCR и экспрессированными генами γ-глобина, что особенно наблюдалось в клетках K562, экспрессирующих γ-глобин. Кроме того, как в клетках K562, так и в клетках GM06990 LCR также взаимодействует с элементом 3′-HS1 и большим доменом, расположенным на 50–100 т.п.о. выше по течению. Последняя область соответствует области вокруг HS-62. 5/ HS-60 в мышином локусе (Farrell et al. 2002; Bulger et al. 2003). Подобные дальнодействующие взаимодействия между HS наблюдались у мышей. Кластеризация этих HS была предложена для создания хроматинового узла или специализированного ядерного компартмента, предназначенного для транскрипции β-globin генов (Tolhuis et al. 2002; de Laat and Grosveld 2003). Некоторые из HS в локусе β-глобина связываются с инсулятор-связывающим белком CTCF (Farrell et al. 2002; Bulger et al. 2003) (и для человеческого HS5 см. Дополнительную фиг.6), и предполагается, что этот белок обеспечивает их взаимодействие и образование хроматинового узла (Patrinos et al. 2004). Однако функциональное значение некоторых из этих взаимодействий не совсем понятно, поскольку делеция некоторых элементов не влияет непосредственно на экспрессию β-globin (Bender et al. 2006). Наше наблюдение, что взаимодействия между несколькими HS также происходят в клетках GM06990, которые никогда не будут экспрессировать β-глобин, предполагает, что они могут не регулировать экспрессию β-глобина напрямую, но участвуют в некоторых аспектах архитектуры хромосом более высокого порядка.

Профили взаимодействия HS5 и HS2/3/4 очень похожи, за исключением того, что HS2/3/4 чаще взаимодействует с локусом β-глобина именно в клетках K562. Этот результат согласуется с наблюдениями, что HS2 и HS3 обладают самой сильной энхансерной активностью (Fraser et al., 1993; Peterson et al., 1996). Кроме того, RNA-TRAP показал, что экспрессируемый ген globin наиболее сильно взаимодействует с HS2 (Carter et al. 2002).

Мы идентифицировали новое петлеобразное взаимодействие хроматина между LCR и областью между генами γ- и δ-глобина.Этот результат интригует, учитывая, что эта область вовлечена в онтогенетический контроль локуса β-globin (O’Neill et al. 1999; Chakalova et al. 2005). Эта область содержит псевдоген β-глобина, который активируется в клетках K562 (дополнение), что позволяет предположить, что петлевое взаимодействие может быть вовлечено в активацию транскрипции. Эта область также содержит промотор большого межгенного транскрипта, экспрессия которого может быть связана с активацией взрослого гена β-globin (Gribnau et al. 2000).Некоторые пациенты, страдающие наследственной персистенцией фетального гемоглобина, имеют делеции в этой области и обнаруживают дефекты экспрессии β-глобина (Chakalova et al., 2005). В отличие от некоторых других петлевых взаимодействий в локусе, CTCF может не играть роли во взаимодействии между LCR и межгенными участками γ–δ, поскольку мы не обнаружили связывания CTCF с несколькими сайтами внутри межгенного участка, несмотря на наличие несколько слабых предполагаемых сайтов связывания CTCF (дополнительная рис. 6).

Детектирование с помощью микрочипов и количественное секвенирование

Результаты, полученные с помощью детектирования с помощью микрочипов, количественного секвенирования и полуколичественной ПЦР, как правило, очень сопоставимы.Однако мы также наблюдали несколько отличий. Во-первых, динамический диапазон обнаружения микрочипов был меньше, чем у количественного секвенирования, как это наблюдалось ранее (Yuen et al. 2002). Во-вторых, наблюдались небольшие количественные различия между наборами данных, полученных с помощью микрочипового анализа, количественного секвенирования и полуколичественной ПЦР, например, в межгенной области γ–δ (рис. ). Эти различия могут отражать внутреннюю предвзятость методов обнаружения, но также могут быть связаны с экспериментальными различиями между независимо сгенерированными библиотеками 5C.

Оба метода обнаружения имеют преимущества. Секвенирование ДНК отображает более широкий динамический диапазон и избавляет от необходимости создавать определенный массив для каждой интересующей области генома. С другой стороны, анализ микрочипов в настоящее время более экономичен, особенно когда данный участок генома необходимо анализировать в большом количестве различных условий.

Данные 5C, полученные с помощью секвенирования ДНК, позволили оценить предпосылки подхода, основанного на LMA. Мы количественно оценили 451 взаимодействие между локусом β-глобина и областью пустыни контрольного гена, которые расположены на разных хромосомах.Эти взаимодействия обнаруживаются прямыми праймерами, расположенными на одной хромосоме, и обратными праймерами, расположенными на другой, и наоборот. Нет никаких биологических указаний на то, что локус β-globin и регион генной пустыни должны предпочтительно взаимодействовать. Поэтому мы рассудили, что эти частоты межхромосомных взаимодействий будут соответствовать фоновым сигналам. Как правило, мы обнаружили очень низкие фоновые частоты взаимодействия между двумя областями (средняя частота взаимодействия 0,08 [стандартная ошибка среднего, или S.E.M. = 0,02] для K562 и 0,08 [S.E.M. = 0,01] для GM06990) (дополнительная таблица 6), что в 75 раз ниже, чем частота взаимодействия между HS2/3/4 и геном β-глобина в клетках K562. Однако мы также обнаружили несколько более высоких частот взаимодействия. Мы не знаем, представляют ли они истинные межхромосомные контакты, ложные срабатывания из-за дизайна праймера или экспериментальный шум. Будущие крупномасштабные анализы 5C обеспечат более подробное понимание этих проблем.

Применение 5C

5C основан на мультиплексной амплификации, опосредованной лигированием, и поэтому потенциально ограничен количеством праймеров 5C, которые можно использовать в одной реакции.Другие анализы, основанные на LMA, успешно использовали многие тысячи праймеров в одной реакции. Например, статус метилирования 1534 сайтов CpG оценивали с использованием смеси примерно 6000 праймеров (Bibikova et al. 2005). Другим примером является использование LMA с высокой степенью мультиплексирования с использованием до 20 000 молекулярных инверсионных зондов в одной реакции для обнаружения однонуклеотидных полиморфизмов (SNP) (Hardenbol et al. 2005; Wang et al. 2005). Когда 5C выполняется на аналогичном уровне мультиплексирования, например, с использованием 10 000 праймеров 5C в одном эксперименте, можно параллельно обнаружить до 25 миллионов различных взаимодействий хроматина с участием до 40 Мб (10 000 рестрикционных фрагментов размером 4 т.п.н.) ДНК.

Для мультиплексных анализов 5C важно тщательно разработать праймеры 5C. Девять праймеров 5C, которые использовались для создания проанализированных здесь библиотек 5C, прекрасно распознавали обильные вкрапленные повторы, и было обнаружено, что эти праймеры продуцируют чрезмерно большое количество продуктов лигирования (см. Дополнительную таблицу 5B). Таким образом, следует избегать повторяющихся последовательностей.

Мы предполагаем два типа приложений 5C, которые различаются схемами проектирования 5C. Во-первых, 5C можно использовать для крупномасштабного картирования взаимодействий петель хроматина между конкретными представляющими интерес элементами генома, подобно описанному здесь анализу локуса β-globin.Такие исследования сосредоточены на картировании взаимодействий между «фиксированным» элементом (например, LCR) и другими рестрикционными фрагментами, расположенными в цис- или в транс-, чтобы идентифицировать элементы, с которыми он взаимодействует. 5C позволяет одновременно количественно определять профили взаимодействия многих таких «фиксированных» элементов параллельно в одной реакции с последующим анализом на специально разработанном микрочипе или прямым количественным секвенированием. Для этого обратные праймеры 5C конструируют для каждого представляющего интерес фиксированного фрагмента, а прямые праймеры 5C конструируют для всех остальных рестрикционных фрагментов, как показано на рис. Этот тип анализа позволит быстро обнаружить сети взаимодействий между несколькими генами и регуляторными элементами в больших сегментах генома.

Во-вторых, анализ 5C можно использовать для создания плотных карт взаимодействия, которые охватывают большинство или все потенциальные взаимодействия между всеми фрагментами любой области генома. Карты плотного взаимодействия могут обеспечить глобальный обзор конформации данной области генома. Например, когда прямые и обратные праймеры 5C разработаны для чередующихся фрагментов рестрикции, как это сделано здесь для контрольной области пустыни гена (), относительно плотная матрица частот взаимодействия может быть быстро получена по всей геномной области.Несмотря на свою эффективность, такой анализ 5C не дает полной карты взаимодействия для данной области генома, поскольку взаимодействия между двумя фрагментами, которые распознаются как прямыми, так и обратными праймерами, не могут быть обнаружены. Это ограничение можно преодолеть, выполнив несколько анализов 5C, каждый с переставленной схемой дизайна праймера 5C для получения частично перекрывающихся матриц взаимодействия. В сочетании эти карты могут давать полные карты взаимодействия, содержащие частоты взаимодействия всех пар рестрикционных фрагментов в интересующей области.Каждая строка и столбец таких матриц будет соответствовать эксперименту с «фиксированным» элементом, как описано выше. Генерация полных матриц взаимодействия может быть использована в качестве инструмента обнаружения для беспристрастного обнаружения взаимодействий петель хроматина между ранее неаннотированными элементами. Анализ матрицы частот взаимодействия также может предоставить глобальную информацию относительно общей пространственной конформации геномной области (Dekker et al. 2002; Gheldof et al. 2006).

Методы

Подготовка ВАС-селекции и контрольной библиотеки

Контрольная библиотека для человеческого локуса β-глобина и областей генной пустыни (регионы ENCODE ENm009 и ENr313 соответственно) была создана, как описано (Dekker 2006; Miele et al.2006). Вкратце, массив бактериальных искусственных хромосом (ВАС), покрывающих обе геномные области, смешивали, расщепляли с помощью EcoRI и случайным образом лигировали. В этом исследовании массивы BAC из локуса β-глобина и областей генной пустыни были смешаны в соотношении 4: 1 для получения сильных сигналов для локуса β-глобина. Соответственно были скорректированы частоты взаимодействия. Для области β-глобина использовали следующие семь клонов ВАС: CTC-775N13, RP11-715G8, CTD-3048C22, CTD3055E11, CTD-2643I7, CTD-3234J1 и RP11-589G14.Набор из четырех клонов BAC был отобран для охвата области пустыни с геном 0,5 Мб и включает RP11-197K24, RP11-609A13, RP11-454G21 и CTD-2133M23. Клоны ВАС были получены от Invitrogen и Оклендского научно-исследовательского института детской больницы (CHORI).

Культура клеток и анализ 3C

Клеточная линия GM06990 была получена из В-лимфоцитов, трансформированных EBV, и была получена из репозиториев клеток Coriell (CCR). Эту клеточную линию культивировали в среде 1640 Мемориального института Розуэлл-Парк (RPMI 1640) с добавлением 2 мМ L-глутамина и 15% фетальной бычьей сыворотки (FBS).Клеточная линия K562 была получена из Американской коллекции типовых культур (ATCC) и культивирована в среде RPMI 1640 с добавлением 2 мМ L-глутамина и 10% FBS. Обе клеточные линии выращивали при 37°C в 5% CO 2 в присутствии 1% пенициллина-стрептомицина. Анализ 3C проводили с использованием клеток GM06990 и K562 в логарифмической фазе с использованием EcoRI, как описано ранее (Dekker et al. 2002; Vakoc et al. 2005; Miele et al. 2006). Последовательности праймеров представлены в дополнительной таблице 2.

Количественная оценка ПЦР в реальном времени

Тотальную РНК из клеток логарифмической фазы выделяли с помощью набора RNeasy Mini Kit, как описано производителем (Qiagen).кДНК синтезировали с олиго(dT) 20 (Invitrogen) с использованием набора для обратной транскрипции Omniscript (Qiagen). Транскрипты β-глобина количественно определяли с помощью ПЦР в реальном времени в присутствии красителя SYBR Green I (Molecular Probes). Специфические праймеры для β-глобина человека, использованные в этом анализе, приведены в дополнительной таблице 1.

Дизайн праймера 5C

Прямые и обратные праймеры были разработаны для распознавания верхней или нижней цепи 3′-конца рестрикционных фрагментов EcoRI. Длина гомологии праймеров варьировала от 24 до 40 нуклеотидов, а температура плавления была сосредоточена на уровне 72°C. Геномная уникальность всех праймеров была проверена с помощью алгоритма SSAHA (Ning et al. 2001). Прямые праймеры 5C были разработаны так, чтобы включать 5′-концевой хвост, который включает (5’–3′) CTG, за которым следует один сайт рестрикции MmeI (TCCAAC) и модифицированную последовательность универсального праймера T7 (TAATACGACTCACTATAGCC). Обратные праймеры 5C были разработаны так, чтобы включать 3′-концевой хвост, который включает (5′-3′) модифицированную комплементарную универсальную последовательность T3 (TCCCTTTAGT GAGGGTTAATA) и один сайт рестрикции MmeI (GTCGGA), за которым следует CTC.Прямой и обратный праймеры 5С содержали по половине сайта рестрикции EcoRI, и только обратные праймеры были фосфорилированы на 5′-конце. Все праймеры 5C представлены в дополнительной таблице 3.

Подготовка библиотеки 5C

Библиотеку 3C (представляющую примерно 150 000 копий генома) или контрольную библиотеку (5 нг) смешивали с ДНК семенников лосося (Sigma) до общей массы ДНК 1,5. мкг и 1,7 фмоль каждого праймера 5C в конечном объеме 10 мкл буфера для отжига (20 мМ трис-ацетат при pH 7.9, 50 мМ ацетата калия, 10 мМ ацетата магния и 1 мМ ДТТ). Образцы денатурировали в течение 5 мин при 95°С и отжигали в течение 16 ч при 48°С. Отожженные праймеры лигировали в течение 1 ч при 48°C, добавляя 20 мкл буфера для лигирования (25 мМ Трис-HCl при рН 7,6, 31,25 мМ ацетата калия, 12,5 мМ ацетата магния, 1,25 мМ НАД, 12,5 мМ ДТТ, 0,125% Тритона Х). -100), содержащую 10 единиц ДНК-лигазы Taq (NEB). Реакции останавливали инкубацией образцов при 65°С в течение 10 мин. Продукты лигирования 5C амплифицировали методом ПЦР с использованием прямого (T7modif, CTGTCCAACTAA TACGACTCACTATAGCC) и обратного (T3modif, GAGTCCGAC TATTAACCCTCACTAAAGGGA) праймеров.Шесть микролитров реакции лигирования амплифицировали с 10 пмоль каждого праймера в 25-мкл реакциях ПЦР (32 цикла по 30 с денатурации при 95°С, 30 с отжига при 60°С и 30 с удлинения при 72°С). ). Библиотеки 5C очищали с помощью набора MinElute Reaction Cleanup Kit (Qiagen) для удаления невключенных праймеров и других загрязнителей в соответствии с рекомендациями производителя.

Singleplex и sixplex Анализ 5C

Библиотеки 5C из K562 и GM06990 (каждая представляет ~150 000 геномов) или контрольные библиотеки (5 нг) инкубировали с отдельными парами праймеров 5C и обрабатывали, как описано выше, за исключением того, что реакции лигирования амплифицировали с помощью 35 Циклы ПЦР: 30 с денатурации при 95°С, 30 с отжига при 60°С и 30 с удлинения при 72°С.Амплифицированные продукты лигирования 5C разделяли на 2% агарозных гелях и визуализировали бромистым этидием (0,5 мкг/мл). Анализ Sixplex 5C проводили путем смешивания шести различных праймеров 5C с 3C или контрольными библиотеками. Индивидуальные продукты лигирования 5C в образцах шестиплексов обнаруживали с помощью ПЦР со специфическими внутренними праймерами для ПЦР и измеряли на агарозных гелях, как описано выше. Обнаружение продуктов 5C с помощью ПЦР с линейным диапазоном было подтверждено двукратным титрованием серийных разведений мультиплексных образцов. Последовательности внутренних праймеров доступны по запросу.

Анализ микрочипа библиотеки 5C

Библиотеки 5C были приготовлены путем проведения мультиплексной LMA с 78 праймерами 5C и амплифицированы с 5′-Cy3-меченым обратным праймером для ПЦР, комплементарным общей 3′-концевой хвостовой последовательности обратных праймеров 5C (Cy3 -T3modif). Синтез безмасочной матрицы и гибридизацию проводили со 100 нг амплифицированных библиотек 5C в NimbleGen Systems Inc., как описано ранее (Singh-Gasson et al., 1999; Nuwaysir et al., 2002; Kim et al., 2005; Selzer et al.2005). Каждая матрица содержала смысловую цепь предсказанных продуктов лигирования 5C. Массивы также содержали несколько межрегиональных отрицательных контролей. Массивы содержали 18 повторов увеличивающейся длины признаков в диапазоне от 30 до 64 нт, которые использовались для определения оптимальной длины зонда массива (дополнение). Полное описание конструкции массива предоставляется по запросу. Массивы сканировали с использованием сканера GenePix4000B (Axon Instruments, Molecular Devices Corp. ) с разрешением 5 мкм. Данные из отсканированных изображений были извлечены с помощью NimbleScan 2.0 (NimbleGen Systems, Inc.).

Высокопроизводительный анализ секвенирования ДНК библиотеки 5C

Библиотеки 5C были созданы с использованием 73 праймеров 5C, как описано в разделе «Результаты». Каждую библиотеку амплифицировали с фосфорилированными 5′-концами ПЦР-праймерами и обрабатывали для одномолекулярного пиросеквенирования, как описано ранее (Margulies et al. 2005). С помощью платформы GS20, разработанной 454 Life Sciences Corp., было получено 550 189 прочтений последовательности на общую сумму 60 миллионов оснований. Средняя длина считывания составила 108 оснований (мода 112 оснований).Каждое чтение было подвергнуто BLAST против всех прямых и обратных праймеров. Для каждого образца подсчитывали количество прочтений, соответствующих каждой из 682 возможных пар праймеров (62 прямых × 11 обратных). Эти комбинации включают 159 возможных взаимодействий в локусе β-глобина, 72 взаимодействия в области генной пустыни и 451 взаимодействие между регионами. Данные обобщены в дополнительных таблицах 4 и 5.

  1. Последнее обновление
  2. Сохранить как PDF
  • Идентификатор страницы
    26483
  • vecd} [1] {\ overset {- \! — \! \ rightharpoonup} {\ vphantom {a} \ smash {# 1}}} \) \ (\ newcommand {\ id} {\ mathrm {id}} \ ) \( \newcommand{\Span}{\mathrm{span}}\) \(\newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range }\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\ mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle} \) \( \newcommand{\Span}{\mathrm{span}}\) \(\newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span} }\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{ \mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm} [1]{\| #1 \|}\) \( \newc ommand{\inner}[2]{\langle #1, #2 \rangle}\) \(\newcommand{\Span}{\mathrm{span}}\)

    Без заголовков
    1. Наверх
      • Рисунок 6. 2.14c Способ шайбы 3
      • Рисунок 12.2.7 Линии наклона
    • Была ли эта статья полезной?
    • Да
    • Нет
    1. Тип изделия
      Книга или модуль
      Показать страницу Содержание
      нет
    2. Теги
        На этой странице нет тегов.

    Как провести анализ 5с

    Как специалист по маркетингу, вы должны противостоять одной вещи; искушение принимать решения, основанные на прихоти или инстинкте. Неспособность проверить свои предположения может стать началом очень скользкой дорожки.

    Чтобы помочь вам принимать разумные решения, возьмите страницу из книг коллег-PMM и обратитесь к 5с маркетинга. Анализ 5c, особенно подходящий для малого и среднего бизнеса, завоевал поклонников во многих уголках делового мира благодаря своей простоте и легкости.

    Но что такое анализ 5с и какие вопросы вам нужно задать, чтобы получить больше информации о вашем бизнесе? Давайте взглянем.

    Что такое анализ 5с? Анализ

    5c используется компаниями, чтобы помочь им оценить и понять потенциальные проблемы, с которыми им, возможно, придется столкнуться в будущем. Завершив процесс, вы сможете определить, какие области вашего бизнеса работают хорошо, а какие области нуждаются в улучшении с по , действуя с учетом этих плюсов и минусов.

    Помните, что осознанные решения приводят к меньшему количеству ошибок, которые в целом будут иметь более прибыльный результат для вашей организации.

    Что такое модель 5с?

    В: Сколько C в модели 5c?

    Неудивительно, что модель 5c основана на 🥁… 5 фундаментальных элементах, каждая из которых напрямую связана с вашей бизнес-моделью.

    Это:

    Компания
    Сотрудники
    Клиенты
    Конкуренты
    Климат

    Оценка этого квинтета поможет вам получить полное представление об основных элементах вашего бизнеса.

    Вопросы, которые следует задать при анализе 5с

    Правильные вопросы составляют огромную часть эффективного анализа 5с.

    Но какие вопросы вам нужно задать, чтобы получить максимальную отдачу от процесса?

    Ваша компания

    Прежде чем обратить внимание на внешние факторы, необходимо разобраться в собственном бизнесе.

    Задайте себе такие вопросы, как:

    1. Что продает ваш бизнес?
    2. Каковы ваши основные продукты?
    3. Каково ваше УТП?
    4. Почему ваши клиенты вынуждены покупать у вашей компании?
    5. Где вы оцениваете своих конкурентов?
    6. Что можно улучшить?
    7. Каковы общие представления о вашем бизнесе?
    8. Какие выгоды получит ваш бизнес от инвестиций?
    9. Какими областями вашего бизнеса можно было бы пожертвовать в случае необходимости?
    10. У вас есть цели для вашего бизнеса?

    Вы можете без проблем пролететь через эти вопросы, но если вы боретесь, не переживайте; сделайте шаг назад и проведите SWOT-анализ своего бизнеса (члены PMA могут загрузить наш очень удобный шаблон SWOT 😉), а затем вернитесь к анализу 5c в будущем.


    Помните: Когда вы отвечаете на эти вопросы, поговорка «честность — лучшая политика» как нельзя более уместна.

    Хотя самокритика может быть трудной, выявление несовершенств и сосредоточение внимания на недостатках поможет вам понять и принять меры в тех областях, в которых вы неэффективны. Неспособность проглотить свою гордость не только сочтет это упражнение неэффективным, но и откроет дверь для ваших соперников, которые могут ворваться и одержать верх.

    После того, как вы ответите на эти вопросы, подавите свое стремление двигаться вперед.Вместо этого подумайте о том, какие чувства у вас вызвали ваши ответы. Используя свои эмоциональные реакции, установите цели на краткосрочные и долгосрочные периоды.

    Например, если вы расстроены тем, как воспринимается ваш бизнес, какие методы вы будете использовать, чтобы изменить восприятие в будущем? Тем не менее, не попадайтесь в ловушку, принимая все на свой счет и действуя на голых эмоциях — все дело в поддержании баланса.

    Соавторы

    После рассмотрения вашей компании пришло время переключить внимание на всех, с кем вы сотрудничаете; это может быть физическое лицо или другая компания.

    Составьте список всех ваших сотрудников, отметив их основное контактное лицо, а также такую ​​информацию, как адреса электронной почты и номера телефонов.

    Вопросы о ваших сотрудниках могут включать:

    1. Кто отвечает за повседневную деятельность в компании?
    2. У вас есть партнер, который помогает вам управлять компанией?
    3. Есть ли в вашей компании инвесторы или заинтересованные лица?
    4. Кто производит, продает и распространяет продукцию вашей компании?
    5. Когда вы отправляете товары, какой компанией вы пользуетесь?
    6. Есть ли какие-либо внешние работники, нанятые компанией, такие как фрилансеры или подрядчики?
    7. Нанимаете ли вы руководителя социальных сетей для создания и публикации контента для ваших учетных записей в социальных сетях?
    8. Есть ли внешние дистрибьюторы вашей продукции?
    9. Кто помогает с маркетингом и/или рекламой?
    10. Есть ли для вас копирайтер или контент-райтер, который пишет материалы для вашей компании?
    11. Кто создал веб-сайт вашей компании и где зарегистрирован домен?
    12. Кто предоставляет вашей компании финансовые консультации?

    Эта часть анализа 5c не только показывает полную картину того, сколько людей требуется для ведения вашего бизнеса, но также позволяет вам точно определить, кто отвечает за конкретные задачи, позволяя вам привлечь конкретных людей к ответственности за ключевые области в вашей установке.

    Вы также можете указать сотрудника, который, по вашему мнению, не вносит эффективного вклада. Это дает возможность найти замену для вашей команды, которая может работать более эффективно.

    Клиенты

    Если оставить в стороне клише, каждый маркетолог должен понимать, что потребности клиентов превыше всего. В конце концов, без клиентской базы ваш продукт не изменится в ближайшее время.

    Вам нужно не только установить, кто ваши клиенты, но и то, насколько ваш продукт соответствует их требованиям.Речь идет не только о создании начальной продажи; вы хотите побудить их вернуться за добавкой и создать базу лояльных клиентов.

    Если вы понимаете своих клиентов, это может помочь вам: а) разработать свой продукт, чтобы отточить то, что они хотят, а не то, что вы хотите им дать, б) эффективно продвигать его и в) внедрить сообщения, которые найдут отклик и добиться положительного ответа.

    В некоторых случаях ваша целевая аудитория включает более одного сегмента, и в этом случае рассмотрите следующее:

    1. Кто ваш идеальный клиент?
    2. Кто ваши целевые персонажи?
    3. Какие люди покупают ваш продукт в настоящее время?
    4. Какие ваши самые популярные продукты? Для сравнения, какие из них плохо продаются?
    5. По вашим отзывам; какие продукты были хорошо приняты? Были ли какие-либо из них предметом негативных отзывов?
    6. Согласно аналитике, какие страницы вашего сайта чаще всего посещают клиенты?
    7. Что покупатели находят интересным или неинтересным в вашем продукте или услуге?
    8. Есть ли какая-то функция, которую пользователи хвалят больше, чем другие?
    9. Как вы поддерживаете связь со своими клиентами?
    10. Ваши клиенты лояльны к вашему бренду или у вас высокий уровень оттока?
    11. Заметили ли вы какие-либо тенденции при проведении рекламных кампаний?
    12. Если ваш клиент хочет получить дополнительную информацию о вашем продукте или услуге, где он заявит о своем интересе?
    13. Почему ваш клиент предпочитает покупать ваш продукт, а не продукт ваших конкурентов?
    14. Ваш клиент определил области для улучшения?

    Информация, полученная в результате ответов на эти вопросы, может быть использована для получения четкого представления о вашем клиенте, а их ответы помогут понять, почему они решили купить ваш продукт, а также какие практические шаги вы можете предпринять, чтобы сделать свой продукт еще лучше.

    Однако получить глубокое представление о ваших клиентах не так-то просто. Многие компании пытаются понять своих клиентов и сталкиваются с трудностями, поэтому не расстраивайтесь, если вы окажетесь в такой же ситуации.

    Тем не менее, если вам посчастливилось получить необходимую информацию, эта информация может иметь решающее значение для получения конкурентного преимущества над другими конкурентами в вашей отрасли.

    Наконец, важно помнить, что покупательские тенденции никогда не останутся прежними.Итак, когда вы узнаете новую информацию о своем клиенте, пересмотрите свой анализ и внесите необходимые поправки в свою стратегию.

    Конкуренты

    Успех зависит не только от того, насколько хорошо вы знаете свою компанию. Вы также должны провести конкурентный анализ, чтобы узнать все, что нужно знать о том, с кем вы сталкиваетесь.

    Помимо использования конкурентных инструментов Intel, вам также необходимо задать себе ключевые вопросы о ваших конкурентах, начиная с:

    1. С какими компаниями вы конкурируете в своей отрасли?
    2. Ваши конкуренты впервые появились на рынке или уже зарекомендовали себя? Или оба?
    3. Для сравнения, уступает ли продукт вашей компании в каких-либо областях по сравнению с продуктом ваших конкурентов?
    4. Прочитайте обзоры их компаний, чтобы определить их сильные и слабые стороны; обратная связь может помочь вам принять решение.
    5. Существует ли определенный тип контента, используемый вашими конкурентами, который был особенно хорошо принят? Если да, то не могли бы вы рассмотреть что-то подобное в своем контент-плане?
    6. Как они привлекают клиентов к своему бренду?
    7. Какие УТП есть у вашего продукта, чтобы выделить вас среди конкурентов?
    8. На каких персонажей нацелен ваш конкурент?
    9. Хорошо ли они представлены в социальных сетях?
    10. Чем они отличаются от вас?

    Это фундаментальный этап анализа 5c; в конце концов, как можно ожидать, что вы будете соревноваться, если вы не знаете, с кем вы соревнуетесь? Когда вы знаете о хитросплетениях своих конкурентов, это позволяет вам использовать их слабости и сводить на нет их угрозу.

    Климат

    Иногда вы делаете все, что в ваших силах, чтобы добиться успеха в вашей компании, только для того, чтобы внешние факторы сговорились против вас.

    Принимая во внимание климат, в котором вы работаете, вам необходимо обращать внимание на внешние факторы, которые могут повлиять на ваши бизнес-операции. Это может включать изменения в законодательстве или новые технологии. Спросите себя:

    1. Существуют ли точки зрения, которые можно считать спорными, бесчувственными или непопулярными?
    2. Изменилась ли экономика? Если да, то как это повлияет на покупательские привычки ваших клиентов?
    3. Если на рынке появились инновации, следует ли их считать конкурентом? Если да, то как вы можете изменить свою стратегию, чтобы противодействовать ее влиянию?
    4. После введения в действие новых законов и нормативных актов подумайте, как новые законы могут: а) помешать вашей текущей практике или б) открыть новые возможности для вашего бизнеса.
    5. Существуют ли какие-либо культурные ориентиры, которые можно было бы использовать для направления сообщений вашего продукта и/или маркетинговых кампаний?

    Эти вопросы дадут вам представление о текущем климате и направлении, в котором движется рынок, и снизят риск возникновения проблем, которых можно избежать.

    Американский универмаг Sears — прекрасный пример того, почему вы всегда должны обращать внимание на климат, в котором работаете. онлайн-ритейл.

    Поскольку все больше людей предпочитают делать покупки в Интернете в условиях пандемии коронавируса, будущее Sears выглядит все более мрачным, поскольку их отказ учитывать рыночные тенденции является огромным фактором их падения.

    Добавьте к этому нежелание Sears инвестировать в свои существующие магазины, и получится довольно печальная история, учитывая, что ритейлер когда-то был одним из ведущих магазинов в США.

    Пример анализа 5c — супермаркет Asda

    Изображение предоставлено Campaign Live
    1. Компания: Asda — сеть супермаркетов, предлагающая покупателям широкий ассортимент товаров, в том числе бакалейные товары, одежду, развлекательные товары и многое другое. Основанная в 1949 году, штаб-квартира компании находится в Лидсе, Йоркшир, графстве, где компания была первоначально создана. У компании также есть дочерняя компания Asda Mobile.
    2. Соавторы : Asda работает вместе с различными поставщиками и производителями продуктов питания по всему миру, включая американский магазин Walmart, его головную организацию. Компания также нанимает и управляет более чем 165 000 сотрудников в своих филиалах и в штаб-квартире.
    3. Покупатели: Хотя магазины компании расположены в основном в Великобритании, по состоянию на апрель 2020 года у Asda был 341 супермаркет по всему миру.Они также доставляют продукцию клиентам на международном уровне.
    4. Конкуренты: Asda конкурирует с множеством конкурирующих супермаркетов. Помимо своих основных конкурентов, таких как Tesco, Sainsbury’s, на рынок вышли такие компании, как Lidl и Aldi.
    5. Климат. Asda последовала примеру Tesco, предложив своим клиентам возможность воспользоваться услугой «нажми и забери», при этом их усилия по улучшению качества покупок в Интернете усилились после вспышки COVID-19. Пандемия побудила многих людей отдать предпочтение онлайн-покупкам, чтобы свести к минимуму потенциальные риски в супермаркетах.

    Популярная структура, используемая во многих отраслях, анализ 5c продолжает помогать компаниям внедрять новые стратегии, обеспечивая при этом ключевое понимание ключевых тенденций.

    Административный кодекс штата Юта, правило R655-11, раздел R655-11-5C – метод анализа | Административный кодекс штата Юта

    Актуально в бюллетене 2021-24, 15 декабря 2021 г.

    А.Процедуры доступен для выбора расчетных землетрясений и связанных с ними движений для конкретных площадок и для оценки устойчивости плотин к этим землетрясениям. Процедуры и методы оценки воздействия на плотины расчетных колебания грунта при землетрясениях варьируются от упрощенных концепций до всеобъемлющих динамические анализы. Когда степень сложности аналитических процедур далеко продвинулись, однако, неопределенность результатов вызывается несовершенством знание входных параметров, полученных в результате полевых исследований и лабораторных исследований программы тестирования.

    B. Степень или объем исследований, исследований, испытаний и анализов, которые могут потребоваться для адекватно определить сейсмобезопасность плотины будет варьироваться от участка к участку. В общем, следующие физические факторы будут указывать на высокий приоритет и большая степень исследований и анализа:

    1. Близость к известным активным недостатки.

    2. Показания материалов низкой плотности в плотине или фундаменте.

    3.Зоны высокого порового давления или потенциала сжижение.

    4. Показания предельная статическая устойчивость.

    5. Отсутствие надлежащих строительных записей для существующих плотин.

    C. Однако независимо от этих факторов один из основных соображений будут «последствия отказа». Высокий и сооружения средней опасности с постоянными бассейнами, которые могут привести к потере жизнь или значительный материальный ущерб в результате неисправности, как правило, требуют больший объем исследований и анализов.

    D. Ниже приводится общий анализ требования, если иное не установлено государственным инженером, к проектированию МСЕ землетрясений:

    1. Насыпи, фундаменты и абатменты, не подверженные разжижению или значительной потере прочности:

    а. Для максимального ускорения 0,2 g или меньше или максимальное ускорение 0,35 g или меньше, если насыпь состоит из глины на глиняном или скальном основании, псевдостатический коэффициент которого составляет не менее 50 процентов от максимального пикового ускорения коренной породы на площадке должно быть используется в анализе стабильности.Минимальный фактор безопасности в анализе должно быть 1.0.

    б. Максимум пиковое ускорение больше, чем указано выше, деформация и осадка анализ должен быть выполнен для оценки ожидаемого полного движения гребня. То оценка должна учитывать возможность образования избыточного порового давления и выполняться как для верхнего, так и для нижнего откосов плотины. Всего движение гребня должно учитывать оседание и потенциальное накопление движения с обеих сторон.Минимальный запас прочности от перелива должно быть 2.0.

    2. Грунты насыпи, фундамента или примыкания, подверженные разжижению или значительная потеря прочности:

    а. А анализ разжижения/потери прочности должен быть выполнен достаточно подробно, чтобы установить границы разжижаемых/потеряющих прочность грунтов и физические характеристики почвы во время и сразу после расчетное землетрясение.

    б. Почта следует провести анализ сейсмостойкости, чтобы показать, что насыпь стабилен после разжижения/потеря прочности с минимальным коэффициентом безопасность 1.2. Вероятность образования избыточного порового давления будет обдуманный.

    с. Рассчитано деформация и осадка насыпи должны привести к общему смещению гребня с минимальным коэффициентом безопасности от перелива 3,0. Анализы будут учитывать разжижение/потерю прочности и возможность избыточного порового давления поколение.

    3. Прочее могут потребоваться более сложные аналитические процедуры по усмотрению Государственный инженер, где условия требуют более подробного исследования.

    Э. Дополнительно анализу деформации и разжижения необходимо будет оценить возможность внутренней эрозии и растрескивания. Суждение должно быть использовано для принятия решения будет ли эрозия иметь тенденцию к самозаживлению в результате фильтрация.

    F. Строительство плотин на активных разломах не будет разрешено, если не будут представлены доказательства, и одобрено Государственным инженером, что плотина может безопасно выдержать предполагаемый зачет.

    Г. Оценка плотины в условиях КБО должны быть завершены методами, аналогичными тем описано для МКЭ. В условиях нагрузки КБО плотина должна не испытывают значительных повреждений.

    Юта Админ. Код Р655-11-5С

    Директор

    FBI говорит, что его взлом предназначен только для iPhone 5C; федералы обсуждают метод обмена информацией с Apple

    ФБР еще не решило, делиться ли с Apple Inc. подробностями о том, как бюро взломало iPhone, связанный с расследованием терроризма в Калифорнии, заявил директор бюро в среду.

    Джеймс Коми обсудил ситуацию во время выступления в среду вечером в колледже Кеньон в Огайо. Он назвал их способность проникнуть в iPhone «технологическим краеугольным камнем» и сказал, что недостаток, который использовало ФБР в программном обеспечении Apple, работает только на «узком сегменте телефонов» — iPhone 5C, работающем под управлением 9-й версии мобильной операционной системы Apple, а не на новых или старых моделях.

    «Если мы скажем Apple, они это исправят, и мы вернемся к тому, с чего начали», — сказал Коми. — Как бы глупо это ни звучало, мы можем оказаться там.Мы просто еще не решили».

    Министерство юстиции прекратило свою судебную тяжбу, чтобы заставить Apple предоставить ему специализированное программное обеспечение, которое позволило бы ФБР взломать iPhone, которое было выдано инспектору здравоохранения округа Сан-Бернардино Сайеду Фаруку. В декабре Фарук и его жена Ташфин Малик убили 14 человек; пара погибла в перестрелке с властями.

    iPhone был найден в машине на следующий день после стрельбы. Два личных телефона были найдены уничтоженными настолько, что ФБР не смогло полностью восстановить информацию с них.

    Судья США Шери Пим приказала Apple предоставить ФБР программное обеспечение, которое поможет взломать рабочий iPhone Фарука после того, как правительство заявило, что только Apple может помочь властям получить доступ к зашифрованному и заблокированному iPhone. Приказ вызвал дискуссию о противопоставлении прав на цифровую неприкосновенность частной жизни интересам национальной безопасности.

    Коми сказал университетской аудитории, что этот случай также вдохновил многих на попытку взломать телефон — «все и его дядя Фред звонили нам с идеями.

    «Кто-то вне правительства, в ответ на это внимание, придумал решение», — сказал Коми. «Тот, который, я уверен, будет тщательно защищен и будет использоваться законно и надлежащим образом».

    Затем правительство «приобрело инструмент, который позволяет суду получить доступ к телефону», сказал Коми. Правительство отказалось раскрыть личность третьего лица, которое позволило получить доступ к iPhone по делу.

    «ФБР очень хорошо хранит секреты, и люди, у которых мы это купили — я знаю о них довольно много, и у меня есть высокая степень уверенности в том, что они очень хорошо умеют защищать это, и их мотивы совпадают с наш, — сказал Коми.

    Комментарии Коми были самым близким намеком на то, может ли ФБР сделать что-либо, зная об уязвимости в программном обеспечении Apple, которая может позволить кому-то обойти встроенные цифровые замки для доступа к личной информации. Остается неясным, может ли ФБР поделиться подробностями об этой технике с государственными или местными полицейскими органами или правоохранительными органами, и если да, то когда.

    Решение ФБР явно не поможет Manhattan Dist. Атти. Сайрус Вэнс, который сообщил комиссии Конгресса, что у него есть 205 айфонов, данные с которых его следователи не могут получить в ходе уголовных расследований.По словам его офиса, ни один из этих телефонов не является iPhone 5C.

    ФБР часто получает запросы от местных отделов на помощь в криминалистической экспертизе мобильных телефонов, включая доступ к заблокированным телефонам и работу с удаленным и зашифрованным содержимым или поврежденным оборудованием.

    Бюро сообщило, что оно получило запросы на техническую помощь от правоохранительных органов штата и местных органов власти по более чем 500 мобильным телефонам в течение четырех месяцев, начиная с 1 октября, и отвечает в каждом конкретном случае.

    Коми сказал, что новый метод доступа к iPhone «весьма скоропортящийся», независимо от того, будет ли он раскрыт, и исчезнет, ​​если Apple изменит свое программное обеспечение. По его словам, оно также исчезнет, ​​если будет использовано в уголовном деле, где оно должно быть раскрыто в процессе расследования, и станет достоянием гласности.

    Зашифрованный телефон в калифорнийском кейсе был защищен кодом доступа, который включал в себя протоколы безопасности: временную задержку и функцию самоуничтожения, которая стирала данные телефона после 10 попыток.Эти две функции сделали невозможным повторное и постоянное тестирование паролей правительством.

    ТАКЖЕ

    Полное освещение: борьба Apple с ФБР

    A МЕТОД МОДЕЛИРОВАНИЯ ДАННЫХ 5C

    Повышение качества разработки базы данных конечного пользователя: Метод моделирования данных 5C

    VOL IX, No.2, 2008 310 Вопросы информационных систем

    4. После того, как вы закончите, каждая таблица должна быть

    связана по крайней мере с одной другой таблицей.

    ЗАКЛЮЧЕНИЕ

    Метод 5C предлагает простые и понятные

    шаги для обучения восходящему проектированию баз данных. Мы

    считаем, что метод 5C является ценным дополнением и

    дополнением к обучению работе с базами данных. Никто не будет использовать

    метод 5C в качестве единственного охвата проекта базы данных

    .На наш взгляд,

    учащиеся также должны понимать обоснование концепций нормализации

    и ERD и развивать навыки, необходимые для определения функциональных зависимостей в первом

    месте. Чтобы доказать эффективность метода моделирования

    данных 5C, в будущем мы проведем сравнительное исследование традиционного метода и метода 5C.

    ССЫЛКИ

    1. Алави, М., Нельсон, Р. Р., и Вайс, И.R. (1987)

    Стратегии для вычислений конечных пользователей: Интегративная структура

    , Journal of Management

    Информационные системы, 4(3), 28-49.

    2. Алави М., Филлипс Дж. С. и Фридман С. М.

    (1990). Эмпирическое исследование двух

    альтернативных подходов к управлению процессом разработки приложений для конечных пользователей, База данных,

    20(4), 11-19.

    3. Батра Д., Хоффер Дж. А. и Бостром Р. П.

    (1990). Сравнение представлений с реляционной и EER-моделями

    , Связь

    ACM, 33(2), 126-139.

    4. Батра, Д. и Энтони, С.Р. (1994). Влияние данных

    модели и характеристик задачи на производительность конструктора

    : лабораторное исследование, International

    Journal of Human-Computer Studies, 41(4),

    481-508.

    5. Чан, Х., Сиау, К. и Вей, К-К. (1998).

    Влияние модели данных, системы и задач

    на производительность пользовательских запросов:

    эмпирическое исследование, База данных, 29(1), 31-49.

    6. Чан, Х.К., Тео, Х.Х., и Цзэн, Х.Х. (2005).

    Оценка производительности конечных пользователей-новичков

    : моделирование данных, написание запросов и понимание

    , Journal of the American Society

    for Information Science and Technology, 56(8),

    843-853.

    7. Чен, П. П. (1976) Модель сущность-связь

    — к единому представлению данных. ACM

    Транзакции в системах баз данных, 1(1), 9-36.

    8. Фишер Г., Джаккарди Э., Е Ю., Сатклифф А.

    Г. и Механджиев Н. (2004). Метадизайн: Манифест

    для разработки конечных пользователей.

    Связь АКМ, 47(9), 33-37.

    9. Говиндараджулу, К. (2003). Конечные пользователи: Кто такие

    они, Communications of the ACM, 46(9), 152-

    159.

    10. Хоффер, Дж. А., Прескотт, М. Б., и Макфадден, Ф.

    Р. (2007). Современное управление базами данных, 8-е изд.

    ., Прентис-Холл, Аппер-Сэдл-Ривер, Нью-Джерси.

    11. Джанврин Д. и Моррисон Дж. (2000). Использование структурированного подхода к проектированию

    для снижения рисков в конце

    разработки электронных таблиц пользователей, информации и

    управления, 37(1), 1-12.

    12. Джавахар, И. М. и Эланго, Б. (2001). Влияние

    отношения, постановки целей и самоэффективности на конечную

    производительность пользователя, Journal of End User

    Computing, 13(2), 40-45.

    13.Крей, Дж., Кронан, Т.П., Пендли, Дж., и Ренвик,

    Дж. С. (2000). Разработка приложений конечными пользователями

    : можно ли улучшить качество, решение

    Support Systems, 29(2), 143-152.

    14. Крук, С.Э., Махер, Дж.Дж., Бархи, Р. (2003).

    Framework для приобретения когнитивных навыков и

    обучение работе с электронными таблицами для конечных пользователей, Journal of End

    User Computing, 15(1), 20-37.

    15. Кунг Х. и Райхгельт Х. (2004).Альтернативный метод

    для улучшения обучения студентов IS / IT нормализации базы данных

    , Journal of Informatics

    Education Research, 6 (3), 45-55.

    16. Ляо, К. и Палвия, П. К. (2000). Влияние моделей данных

    и сложности задач на производительность конечных пользователей

    : экспериментальное исследование,

    International Journal of Human-Computer

    Studies, 52(5), 831-845.

    17. Либерман Х., Патерно Ф., Кланн М. и Вульф,

    В.

    Похожие записи

    Вам будет интересно

    Топ вакансий в москве: Лучшие вакансии недели

    Рынок канцелярских товаров: Рынок канцтоваров: текущая ситуация с поставщиками

    Добавить комментарий

    Комментарий добавить легко